0
Want this question answered?
Be notified when an answer is posted
Add your answer:
Earn +20 pts
Does BSNL provide CUG scheme?
yes, BSNL provides CUG scheme. The conditions varies depending on the number of members in the group. BSNL also provides VPN schemes
What strand mrna would be produced from the strand of DNA gca tta?
UGA CUG
How do you write a CUG SIM Request letter to Mobile company?
[object Object]
What is the name of small lion?
A young lion is called a cub.
How do you translate this to to messenger RNA from DNA ccg atc gac cga?
The messenger RNA sequence would be: CCG UAG CUG GCU
How many mRNA sequences can code for the simple tripeptide sequence leu-met-tyr?
12: UUA-AUG-UAU UUA-AUG-UAC UUG-AUG-UAU UUG-AUG-UAC CUU-AUG-UAU CUU-AUG-UAC CUC-AUG-UAU CUC-AUG-UAC CUA-AUG-UAU CUA-AUG-UAC CUG-AUG-UAU CUG-AUG-UAC
What strand of mrna would be produced from the strand of DNA shown below gct aag?
GCT AAG would produce the strand of mRNA of "CGA UUC" CGU AAU UGA CUG
What is the corresponding mrna section of 3'-tgt-ggg-gtt-att-5'?
The mRNA sequence which is complementary to the DNA sequence 5' - GAC ATG GAA - 3' is:3' - CUG UAC CUU - 5'
What are the codons and anticodons for the sequence auguucguuaacgaccaaauuuaa?
It would be UAC. RNA does not use thymine. It replaces it with Uracil. So instead of TAC it will be UAC.
What is a peekage and a fuzz?
"Peekage" is not a commonly used term, so it is unclear what it refers to. "Fuzz" typically refers to a type of distortion effect in electric guitar pedals or amplifiers that adds a fuzzy or buzzy tone to the sound. It is popular in genres like rock and blues.
What are some seven letter words with 3rd letter C and 4th letter U and 5th letter G and 7th letter A?
According to SOWPODS (the combination of Scrabble dictionaries used around the world) there are 1 words with the pattern --CUG-A. That is, seven letter words with 3rd letter C and 4th letter U and 5th letter G and 7th letter A. In alphabetical order, they are: vicugna
What are some eight letter words with 3rd letter C and 4th letter U and 5th letter G and 7th letter A?
According to SOWPODS (the combination of Scrabble dictionaries used around the world) there are 1 words with the pattern --CUG-A-. That is, eight letter words with 3rd letter C and 4th letter U and 5th letter G and 7th letter A. In alphabetical order, they are: vicugnas
