0
What is the base sequence for a DNA strand when given the sequence for a mRNA strand?
Wiki User
∙ 8y agoWant this question answered?
Be notified when an answer is posted
Add your answer:
Earn +20 pts
If the base sequence of template strand is GCCATTAC what would the base sequence of the mRNA?
The mRNA will have codons AUG-CCA-GUA-GGC-CAC
How would the following base sequence be coded for in mrna cag tgc acg?
Recall for any DNA sequence, there are actually two sequences because DNA is a double helix composed of two strands. By convention (a thankfully logical convention) we typically record the DNA sequence of the "sense strand" from the 5' end to the 3' end. The sense strand was chosen because the sense DNA sequence is exactly the same as the mRNA sequence except that it has T's where RNA has U's. Thus if the sequence you provided is the sense strand 5'-acagtgc-3', then the mRNA sequence would be 5'-acagugc-3'. However, if what you were asking for is what mRNA sequence would be transcribed from the given DNA sequence, that would depend if you'd given me the sequence 5' to 3' or 3' to 5'. If you've given me the sequence of the antisense strand, 3' to 5' (that is, if you're asking what would happen if an RNA polymerase landed at the left of the sequence and began moving right) the mRNA sequence would be ugucacg. If you've given me the sequence of the antisense strand 5' to 3', then the answer would be gcacugu. I'm sorry if I made this more complicated for you.... I have a feeling you were looking for a simpler answer than this.
If a portion of a DNA strand has the base sequence ACGACG what will be the base sequence of the mRNA strand transcribed?
That mRNA sequence had to come from the complement to it. Remeber that the sequence is normally read 5' to 3'. The complement that produced it would be seen in the 3' to 5' orientation (reverse) during transcription. Therefore, find the complement source by reading the sequence in reverse and making the following substitutions: a becomes t, u becomes a, g becomes c, and c becomes g. The result is the following DNA source sequence read 5' to 3': ctaagtcgcaatttttggcat.
DNA sequence acgtt will give what mRNA base sequence?
UGCAA
The order of bases in a molecule of mRNA is determined by the sequence?
The base sequence of mRnas is 'determined by the base sequence of nucleotides in Dna.' The base sequence is transformed into information via the triplet codons of The Genetic Code.
A DNA strand with the base sequence tgacgca codes for a strand of mrna the mrna will have what base sequence?
Remember that in rna Uracil replaces Thymine so ACUGCGU.
If the base sequence of template strand is GCCATTAC what would the base sequence of the mRNA?
The mRNA will have codons AUG-CCA-GUA-GGC-CAC
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complimentary DNA sequence would be TAGGCGATTGCATTGGG. The complimentary mRNA sequence would be UAGGCGAUUGCAUUGGG.
What is a anyi-codon?
an anticodon is a base sequence on tRNA which is completmently to the codon on the mRNA strand.
A segment of DNA has the following sequence TTAAGGCC. Which sequence of bases would be found on the complementary strand of mRNA?
The complimentary strand of MRNA would be AAUUCCGG.
What is is called when RNA copies to DNA?
When RNA's base sequence is used to determine the base sequence of a new strand of DNA, that is called reverse transcription.This is because the process is the reverse of transcription, which involves copying the base sequence of DNA to form RNA, including messenger RNA (mRNA).
What would the DNA sequence have been for the following mrna strand cuc-aag-ugc-uuc?
mRNA forms a complementary sequence to the DNA it is transcribed from. Therefore, the DNA strand would be the complement (opposite base pair) from what is present in the mRNA. Also, remember that RNA uses uracil (U) in place of thymine (T). For the mRNA strand CUC-AAG-UGC-UUC, the complementary DNA strand would be GAG-TTC-ACG-AAG.
How would the following base sequence be coded for in mrna cag tgc acg?
Recall for any DNA sequence, there are actually two sequences because DNA is a double helix composed of two strands. By convention (a thankfully logical convention) we typically record the DNA sequence of the "sense strand" from the 5' end to the 3' end. The sense strand was chosen because the sense DNA sequence is exactly the same as the mRNA sequence except that it has T's where RNA has U's. Thus if the sequence you provided is the sense strand 5'-acagtgc-3', then the mRNA sequence would be 5'-acagugc-3'. However, if what you were asking for is what mRNA sequence would be transcribed from the given DNA sequence, that would depend if you'd given me the sequence 5' to 3' or 3' to 5'. If you've given me the sequence of the antisense strand, 3' to 5' (that is, if you're asking what would happen if an RNA polymerase landed at the left of the sequence and began moving right) the mRNA sequence would be ugucacg. If you've given me the sequence of the antisense strand 5' to 3', then the answer would be gcacugu. I'm sorry if I made this more complicated for you.... I have a feeling you were looking for a simpler answer than this.
Difference between sense and anti sense strands of DNA?
The sense strand has the same base sequence as mRNA with uracil instead of thymine. The antisense strand is transcribed.
A segment of DNA has the following sequence ttaaggcc which sequence of bases would be found on the complementary strand of mrna?
TGCA
If a portion of a DNA strand has the base sequence ACGACG what will be the base sequence of the mRNA strand transcribed?
That mRNA sequence had to come from the complement to it. Remeber that the sequence is normally read 5' to 3'. The complement that produced it would be seen in the 3' to 5' orientation (reverse) during transcription. Therefore, find the complement source by reading the sequence in reverse and making the following substitutions: a becomes t, u becomes a, g becomes c, and c becomes g. The result is the following DNA source sequence read 5' to 3': ctaagtcgcaatttttggcat.
If the sequence of bases in one DNA strand is TAG then the sequence of bases in the other strand will be?
The corresponding mRNA strand would be AUCG.
