0
What is the complementary mrna starnd to dna sequence cggatcat?
Wiki User
∙ 11y ago
GCCUAGUA
Wiki User
∙ 11y ago
Add your answer:
Earn +20 pts
What is the complementary mRNA sequence to the DNA sequence A-A-T-G-G-C?
The complimentary mRNA sequence would be: U-A-A-C-G-U
What is the complementary DNA sequence to AATCCGAT is?
In the cases of MRNA and DNA there are differences in the base pairs that make up the two compounds. In a situation in which Adenosine, Thymine, and Cytosine would need to be paired between DNA and RNA Guanine would be used on the RNA side.
In genetics what does complementary DNA mean?
Complementary DNA (cDNA) is DNA that has been copied from an mRNA through a reverse transcriptase enzyme. cDNA contains a copy of the original DNA sequence that made the mRNA - but without the introns (as these are cut out to create mRNA).
What sequence of mRNA would go with the DNA sequence of act?
If the DNA sequence is ACT, the complimentary mRNA sequence would be UGA
What would be the mrna base sequence formed during transcription using the DNA sequence below?
Transcription produces a strand of messenger RNA that is complementary to the DNA that it transcribed. For example, the DNA sequence AGTCGA would be transcribed by messenger RNA as UCAGCU.
What is the complementary mRNA sequence to the DNA sequence A-A-T-G-G-C?
The complimentary mRNA sequence would be: U-A-A-C-G-U
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complimentary DNA sequence would be TAGGCGATTGCATTGGG. The complimentary mRNA sequence would be UAGGCGAUUGCAUUGGG.
A segment of DNA has the following sequence ttaaggcc which sequence of bases would be found on the complementary strand of mrna?
TGCA
A segment of DNA has the following sequence TTAAGGCC. Which sequence of bases would be found on the complementary strand of mRNA?
The complimentary strand of MRNA would be AAUUCCGG.
If the DNA secquence to be transcribed is actg then the resulting mRNA sequence will be?
if the DNA sequence is A C T G then its resulting mRNA sequence will be complementary so it will be T G A C
What would be the base sequence of the complementary mRNA strand?
TGCA
What order of bases on mRNA will match a sequence on tRNA of UUA?
If the tRNA has the sequence UUA, then the mRNA it reads from will have the sequence complementary to UUA, which is AAU. RNA uses the nucleic acid uracil instead of the DNA counterpart, thymine.
What is a ''codon''?
A three-nucleotide sequence in mRNA that specifies a particular amino acid or polypeptide termination signal; basic unit of the genetic code. In translation, an mRNA codon is recognized by its complementary tRNA anti-codon.
What is the complementary sequence for this DNA c-t-a-a-g-t-c?
To find the complementary sequence for a given DNA sequence, you need to match each nucleotide with its complementary base according to the base-pairing rules. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Given the DNA sequence: C - T - A - A - G - T - C The complementary sequence would be: G - A - T - T - C - A - G
What is the complementary DNA sequence to AATCCGAT is?
In the cases of MRNA and DNA there are differences in the base pairs that make up the two compounds. In a situation in which Adenosine, Thymine, and Cytosine would need to be paired between DNA and RNA Guanine would be used on the RNA side.
What would the DNA sequence have been for the following mrna strand cuc-aag-ugc-uuc?
mRNA forms a complementary sequence to the DNA it is transcribed from. Therefore, the DNA strand would be the complement (opposite base pair) from what is present in the mRNA. Also, remember that RNA uses uracil (U) in place of thymine (T). For the mRNA strand CUC-AAG-UGC-UUC, the complementary DNA strand would be GAG-TTC-ACG-AAG.
What is converting the info on the mRNA into a sequence of amino acids that make up a protein?
First we convert the nucleic acid into a messenger RNA, mRNA, by the process of transcription. Then, in the ribosome, we convert this mRNA unto a polypeptide ( the amino acid sequence ) by the process of translation.
