0
GATTCG. G connects with C and A with T.
Wiki User
∙ 12y ago
Add your answer:
Earn +20 pts
What is the corresponding mRNA sequence to ATGCCCTAAGTG of an unraveled section of DNA?
The corresponding mRNA sequence of ATGCCCTAAGTG is UACGGGAUUCAC
What is the corresponding sequence to the base sequence TACCGCTT?
ATGGCGAA for DNA AUGGCGAA for RNA
A section of DNA has the base sequence GCTTAA the corresponding messanger RNA base sequence will be?
RNA is copied just like DNA, except thymine (T) is replaced by uracil (U), so the corresponding base sequence for GCTTAA would be CGAAUU
What is the puorpose of anticodons?
a codon is a sequence of 3 nucleotides, the tRNA anticodons is the comlementary pairs with its corresponding mRNA codon.
In DNA what process does the corresponding sequence a-c-t-t-g to t-g-a-a-c occur?
Transcription.
Which statement best explains why some changes in DNA sequence do not change the corresponding protein?
The genetic code is redundant
If the sequence of bases in one DNA strand is TAG then the sequence of bases in the other strand will be?
The corresponding mRNA strand would be AUCG.
Consider a strand of DNA with this sequence AAA tga caa cta cca tct tga gca aca aga what is the corresponding sequence of the other side of the DNA helix how would you get the answer?
tttactgttgatggtagaactcgttgttct
What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg?
I though the question is asking the complimentary strand of the sequence. It would be TCCGGTAATCGGGATAAGCCCATATTTACC. Adenine pairs with thymine and guanine pair up cytosine by hydrogen bonds.
Which base sequence in DNA is complementary to the base sequence atgt?
ATAGCC is complementary to the base sequence TATCGG.
What is the next letter in the pattern for WLCNIT?
To provide necessary context, the original question was "What letter comes next in this sequence? WLCNIT_" Notice the first letter of each word in that question. The answer is S, corresponding to "sequence."
If one strand of the DNA has a base sequence of acggttaactaagc?
Then the corresponding side of the DNA will be tgccaattgattcg. When this side is transcribed, the resulting RNA will look like ugccaauugauucg.
