0
What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg?
Wiki User
∙ 9y ago
I though the question is asking the complimentary strand of the sequence. It would be TCCGGTAATCGGGATAAGCCCATATTTACC. Adenine pairs with thymine and guanine pair up cytosine by hydrogen bonds.
Wiki User
∙ 9y ago
Add your answer:
Earn +20 pts
If one strand of the DNA has a base sequence of acggttaactaagc?
Then the corresponding side of the DNA will be tgccaattgattcg. When this side is transcribed, the resulting RNA will look like ugccaauugauucg.
If you had a small single strand of DNA with the nucleotide sequence cagtact what would the sequence be for the other DNA strand?
gcgtatagtccg is the DNA compliment
Inverted repeat sequence in a single strand DNA?
cruciform dna
What is the amino acid sequence for DNA strand with the base sequence DNA-AGGTACGAT?
Serine, Methionine , Leucine.
Why can you predict the base sequence of one strand in a molecule of DNA if you know the sequence of the others strand?
in DNA, each base pairs up with only one other base
If the sequence of bases in one DNA strand is TAG then the sequence of bases in the other strand will be?
The corresponding mRNA strand would be AUCG.
If a DNA stand sequence tagcaagc what will be the complimentary strand?
The complimentary strand of DNA would have the sequence: tacggctagttgg
If one strand of the DNA has a base sequence of acggttaactaagc?
Then the corresponding side of the DNA will be tgccaattgattcg. When this side is transcribed, the resulting RNA will look like ugccaauugauucg.
Consider a strand of DNA with this sequence AAA tga caa cta cca tct tga gca aca aga what is the corresponding sequence of the other side of the DNA helix how would you get the answer?
tttactgttgatggtagaactcgttgttct
If one strand of DNA has the sequence atgtc what will the sequence of the second strand be?
tacag
What sequence is the sequence of the complementary strand of DNA?
its tcaa
If you had a small single strand of DNA with the nucleotide sequence cagtact what would the sequence be for the other DNA strand?
gcgtatagtccg is the DNA compliment
A strand of DNA contains the base sequence AGTT. What is the sequence of the complementary strand of DNA?
It is wrong. The corresponding DNA strand is: 5' tgc gtg act 3' because you have to do the complementary and then revert it.
Complementary dna sequence?
A complimentary DNA sequence is the genetic code on the partner strand that aligns with and corresponds to (matches) the code on the primary strand. Each nucleotide has a match, A matches T and C matches G, therefore the complimentary sequence for ATCGA is TAGCT.
If the DNA sequence is TAG what is the sequence of the complementary strand of tRNA?
auc
Inverted repeat sequence in a single strand DNA?
cruciform dna
A strand of dna contains the base sequence AGTTwhat is the sequence of the complementary strand of DNA?
tcaa --remember a attracts t while c attracts g
