UUAGCAAAUUUAUAUAACCCGGGCCCGGGCCCCGCGC
DNA is not made into mRNA, it is transcribed by mRNA. The DNA molecule is split into two strands by the enzyme helicase. One strand is the sense strand and the other is the anti-sense strand. Then mRNA nucleotides pair with their complimentary DNA bases on the antisense strand. The enzyme RNA polymerase causes the mRNA nucleotides to bond with one another, forming a strand of mRNA.
The mRNA sequence generated from the DNA strand tgacgca would be acugcgu. This is because mRNA is complementary to the DNA template strand, so DNA base T pairs with mRNA base A, DNA base G pairs with mRNA base C, DNA base A pairs with mRNA base U, and DNA base C pairs with mRNA base G.
The DNA strand that is copied to make mRNA is the template strand of the gene. This strand serves as a template for the RNA polymerase enzyme to synthesize a complementary mRNA strand during the process of transcription.
The sense strand of DNA is the strand that has the same sequence as the mRNA that is transcribed from DNA. The antisense strand is the complementary strand of the sense strand, which is used as a template for mRNA synthesis. The mRNA is transcribed from the antisense strand and contains the same sequence as the sense strand.
One mRNA strand is made.
The strand running in the 3'-5' end will be the one that RNA copies, as this is the direction of transcription
A strand of DNA
A strand of DNA
A strand of DNA
To determine the base sequence of a DNA strand from a given mRNA sequence, you need to consider that mRNA is synthesized from the DNA template strand through a process called transcription. The mRNA bases pair with their complementary DNA bases, where adenine (A) pairs with thymine (T), uracil (U) in mRNA pairs with adenine (A) in DNA, cytosine (C) pairs with guanine (G), and guanine (G) pairs with cytosine (C). Therefore, to find the DNA base sequence, you can convert the mRNA sequence to its corresponding DNA sequence by replacing U with A and reversing the order to get the complementary DNA strand.
During transcription, the mRNA strand is synthesized complementary to the DNA template strand. Given the DNA strand "GCA TAG," the corresponding mRNA strand would be "CUG AUC," where each DNA base pairs with its RNA complement (G with C, C with G, A with U, and T with A).
Uracil pairs with adenine in mRNA and replaces thymine in the DNA strand during transcription.