0
What else can I help you with?
What transcribes mRNA?
DNA transcribes mRNA through a process called transcription. The enzyme RNA polymerase synthesizes the mRNA by reading the DNA template strand and creating a complementary RNA strand. This mRNA molecule carries the genetic information from the DNA to be translated into proteins in the cell.
What type of RNA transcribes the DNA code for protein synthesis?
mRNA
How is dna made into mRNA?
DNA is not made into mRNA, it is transcribed by mRNA. The DNA molecule is split into two strands by the enzyme helicase. One strand is the sense strand and the other is the anti-sense strand. Then mRNA nucleotides pair with their complimentary DNA bases on the antisense strand. The enzyme RNA polymerase causes the mRNA nucleotides to bond with one another, forming a strand of mRNA.
What role does the mRNA fulfill?
Messenger RNA (mRNA) transcribes the DNA, during which it forms a strand of mRNA. It then leaves the nucleus and attaches to ribosomes where it will be translated into an amino acid sequence by transfer RNA (tRNA).
Where in the cell does mRNA transcribe genetic code?
mRNA transcribes genetic code in the cell nucleus. The process of transcription occurs when the enzyme RNA polymerase binds to a specific region of DNA, copies the genetic information, and creates a complementary mRNA strand.
What transcribes mRNA?
DNA transcribes mRNA through a process called transcription. The enzyme RNA polymerase synthesizes the mRNA by reading the DNA template strand and creating a complementary RNA strand. This mRNA molecule carries the genetic information from the DNA to be translated into proteins in the cell.
How do you make a protein from DNA?
mRNA transcribes a strand of DNA and carries the genetic code to a ribosome, where the mRNA code is translated by tRNA into a strand of amino acids, making a protein.
What type of RNA transcribes the DNA code for protein synthesis?
mRNA
How is dna made into mRNA?
DNA is not made into mRNA, it is transcribed by mRNA. The DNA molecule is split into two strands by the enzyme helicase. One strand is the sense strand and the other is the anti-sense strand. Then mRNA nucleotides pair with their complimentary DNA bases on the antisense strand. The enzyme RNA polymerase causes the mRNA nucleotides to bond with one another, forming a strand of mRNA.
A DNA strand with the base sequence tgacgca codes for a strand of mrna the mrna will have what base sequence?
The mRNA sequence generated from the DNA strand tgacgca would be acugcgu. This is because mRNA is complementary to the DNA template strand, so DNA base T pairs with mRNA base A, DNA base G pairs with mRNA base C, DNA base A pairs with mRNA base U, and DNA base C pairs with mRNA base G.
Name of the DNA strand which is copied to make mRNA?
The DNA strand that is copied to make mRNA is the template strand of the gene. This strand serves as a template for the RNA polymerase enzyme to synthesize a complementary mRNA strand during the process of transcription.
Difference between sense and anti sense strands of DNA?
The sense strand of DNA is the strand that has the same sequence as the mRNA that is transcribed from DNA. The antisense strand is the complementary strand of the sense strand, which is used as a template for mRNA synthesis. The mRNA is transcribed from the antisense strand and contains the same sequence as the sense strand.
What is the non template strand?
The difference between the coding strand and the template strand is the coding strand is the strand which contains the coding genes, i.e. the one in which the RNA polymerase reads and transcribes into mRNA. It must have the promoter sequence in the correct orientation for transcription, as follows:5`-TATAATGCGCGCGCGCGCGCGCGC-3`3`-ATATTACGCGCGCGCGCGCGCGCG-5`In this sequence, the top strand is the coding strand, because it contains the promoter (TATAAT) in the correct orientation.However, when transcribed, the mRNA will be as follows:5`-GCGCGCGCGCGCGCGCGCGC-3`This is because the polymerase transcribes from the template strand, on the opposide side to the coding strand, to make it in the same orientation as the coding strand.I hope I have explained it enough for people to understand, however if I haven't please read this article I found which explains it thoroughly:http://www.bio.net/bionet/mm/bioforum/1994-May/008821.html
How many strand of mRNA are transcribed from the two unzipped strands of DNA?
One mRNA strand is made.
What is formed when reverse transcriptase is used on of strand of mrna?
A strand of DNA
What is formed when reverse transcriptase is used on strand of mrna?
A strand of DNA
What is the mRNA of the DNA strand aatcgtttaaatatattgggcccgggcccggggcgcg?
UUAGCAAAUUUAUAUAACCCGGGCCCGGGCCCCGCGC
