To determine the base sequence of a DNA strand from a given mRNA sequence, you need to consider that mRNA is synthesized from the DNA template strand through a process called transcription. The mRNA bases pair with their complementary DNA bases, where adenine (A) pairs with thymine (T), uracil (U) in mRNA pairs with adenine (A) in DNA, cytosine (C) pairs with guanine (G), and guanine (G) pairs with cytosine (C). Therefore, to find the DNA base sequence, you can convert the mRNA sequence to its corresponding DNA sequence by replacing U with A and reversing the order to get the complementary DNA strand.
The mRNA will have codons AUG-CCA-GUA-GGC-CAC
comp : tacctgtttgagttgagt mrna : uaccuguuugaguugagu For comp: just go opposite, c is opposite of g, and a is opposite of t For Mrna: do the same except when you would have a t(thymine) make it a u(uracil) since mrna doesnt have any thymine in it.
The strand running in the 3'-5' end will be the one that RNA copies, as this is the direction of transcription
The nucleotide sequence of the mRNA strand is determined by the DNA template strand during transcription. If the DNA template sequence is, for example, 3'-ATCGTAGC-5', the corresponding mRNA sequence synthesized would be 5'-UAGCAUCG-3'. The mRNA sequence consists of complementary RNA nucleotides, where adenine (A) pairs with uracil (U) and cytosine (C) pairs with guanine (G).
Recall for any DNA sequence, there are actually two sequences because DNA is a double helix composed of two strands. By convention (a thankfully logical convention) we typically record the DNA sequence of the "sense strand" from the 5' end to the 3' end. The sense strand was chosen because the sense DNA sequence is exactly the same as the mRNA sequence except that it has T's where RNA has U's. Thus if the sequence you provided is the sense strand 5'-acagtgc-3', then the mRNA sequence would be 5'-acagugc-3'. However, if what you were asking for is what mRNA sequence would be transcribed from the given DNA sequence, that would depend if you'd given me the sequence 5' to 3' or 3' to 5'. If you've given me the sequence of the antisense strand, 3' to 5' (that is, if you're asking what would happen if an RNA polymerase landed at the left of the sequence and began moving right) the mRNA sequence would be ugucacg. If you've given me the sequence of the antisense strand 5' to 3', then the answer would be gcacugu. I'm sorry if I made this more complicated for you.... I have a feeling you were looking for a simpler answer than this.
The mRNA sequence generated from the DNA strand tgacgca would be acugcgu. This is because mRNA is complementary to the DNA template strand, so DNA base T pairs with mRNA base A, DNA base G pairs with mRNA base C, DNA base A pairs with mRNA base U, and DNA base C pairs with mRNA base G.
The mRNA will have codons AUG-CCA-GUA-GGC-CAC
The sense strand of DNA is the strand that has the same sequence as the mRNA that is transcribed from DNA. The antisense strand is the complementary strand of the sense strand, which is used as a template for mRNA synthesis. The mRNA is transcribed from the antisense strand and contains the same sequence as the sense strand.
The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."
an anticodon is a base sequence on tRNA which is completmently to the codon on the mRNA strand.
The complimentary strand of MRNA would be AAUUCCGG.
comp : tacctgtttgagttgagt mrna : uaccuguuugaguugagu For comp: just go opposite, c is opposite of g, and a is opposite of t For Mrna: do the same except when you would have a t(thymine) make it a u(uracil) since mrna doesnt have any thymine in it.
The strand running in the 3'-5' end will be the one that RNA copies, as this is the direction of transcription
mRNA forms a complementary sequence to the DNA it is transcribed from. Therefore, the DNA strand would be the complement (opposite base pair) from what is present in the mRNA. Also, remember that RNA uses uracil (U) in place of thymine (T). For the mRNA strand CUC-AAG-UGC-UUC, the complementary DNA strand would be GAG-TTC-ACG-AAG.
The complementary base pairing rule for DNA and mRNA is: A pairs with U, T pairs with A, G pairs with C, and C pairs with G. Therefore, the mRNA complementary strand for the DNA sequence TTAAGGCC would be AAUUCCGG.
TGCA
The nucleotide sequence of the mRNA strand is determined by the DNA template strand during transcription. If the DNA template sequence is, for example, 3'-ATCGTAGC-5', the corresponding mRNA sequence synthesized would be 5'-UAGCAUCG-3'. The mRNA sequence consists of complementary RNA nucleotides, where adenine (A) pairs with uracil (U) and cytosine (C) pairs with guanine (G).