0
Recall for any DNA sequence, there are actually two sequences because DNA is a double helix composed of two strands. By convention (a thankfully logical convention) we typically record the DNA sequence of the "sense strand" from the 5' end to the 3' end. The sense strand was chosen because the sense DNA sequence is exactly the same as the mRNA sequence except that it has T's where RNA has U's.
Thus if the sequence you provided is the sense strand 5'-acagtgc-3', then the mRNA sequence would be 5'-acagugc-3'.
However, if what you were asking for is what mRNA sequence would be transcribed from the given DNA sequence, that would depend if you'd given me the sequence 5' to 3' or 3' to 5'. If you've given me the sequence of the antisense strand, 3' to 5' (that is, if you're asking what would happen if an RNA polymerase landed at the left of the sequence and began moving right) the mRNA sequence would be ugucacg. If you've given me the sequence of the antisense strand 5' to 3', then the answer would be gcacugu.
I'm sorry if I made this more complicated for you.... I have a feeling you were looking for a simpler answer than this.
What else can I help you with?
What would be a point mutation on the base sequence TAC CG?
A point mutation in the base sequence TAC CG could involve a change in a single nucleotide. For example, if the first base 'T' is mutated to 'A', the new sequence would be AAC CG. This type of mutation can lead to different amino acids being coded for during protein synthesis, potentially affecting the function of the resulting protein.
An original DNA strand has the following base sequence ACGTAAGCT What base sequence would be produced through transcription?
During transcription, the DNA sequence ACGTAAGCT is translated into a complementary RNA sequence. The base pairing rules dictate that adenine (A) pairs with uracil (U) in RNA instead of thymine (T) found in DNA. Thus, the RNA sequence produced would be UGCAUUCGAA.
During DNA replication what sequence on complementary base pairs will be match to the following sequence ATACGCGTTA?
ji
The information of DNA is actually coded in the sequence of nitrogen containing what?
The information of DNA is coded in the sequence of nitrogen-containing bases: adenine (A), guanine (G), cytosine (C), and thymine (T). These nitrogenous bases form base pairs with each other, with A pairing with T and G pairing with C, to create the genetic code.
What sequence of bases would you expect to see paired with a segment of DNA with base sequence acgtcg?
In DNA, the sequence of bases that would pair with GTACG would be CATGC. In RNA, the sequence of bases that would pair with GTACG would be CAUGC, because in RNA, uracil (U) replaces thymine (T).
What is each one?
Each chromosome has genes on it in the form of coded base nucleotide sequence which is part of DNA.
What would be a point mutation on the base sequence TAC CG?
A point mutation in the base sequence TAC CG could involve a change in a single nucleotide. For example, if the first base 'T' is mutated to 'A', the new sequence would be AAC CG. This type of mutation can lead to different amino acids being coded for during protein synthesis, potentially affecting the function of the resulting protein.
An original DNA strand has the following base sequence ACGTAAGCT What base sequence would be produced through transcription?
During transcription, the DNA sequence ACGTAAGCT is translated into a complementary RNA sequence. The base pairing rules dictate that adenine (A) pairs with uracil (U) in RNA instead of thymine (T) found in DNA. Thus, the RNA sequence produced would be UGCAUUCGAA.
During DNA replication what sequence on complementary base pairs will be match to the following sequence ATACGCGTTA?
ji
What is the base word of consequence?
The base word of consequence is "sequens," which means "following" in Latin.
The information of DNA is actually coded in the sequence of nitrogen containing what?
The information of DNA is coded in the sequence of nitrogen-containing bases: adenine (A), guanine (G), cytosine (C), and thymine (T). These nitrogenous bases form base pairs with each other, with A pairing with T and G pairing with C, to create the genetic code.
What sequence of bases would you expect to see paired with a segment of DNA with base sequence acgtcg?
In DNA, the sequence of bases that would pair with GTACG would be CATGC. In RNA, the sequence of bases that would pair with GTACG would be CAUGC, because in RNA, uracil (U) replaces thymine (T).
What is the complementary DNA base sequence for the following bases AACT?
The complementary DNA base sequence for AACT is TTGA. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base in the original sequence is replaced by its complementary base.
If a strand of DNA were composed of the base sequence ATCG what would be the sequence of it opposing base pairs?
The opposing base pairs for the sequence ATCG in DNA would be TAGC. Adenine pairs with thymine, and cytosine pairs with guanine in DNA.
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."
What would be the complementary strand of DNA for the following sequence AATGCTGATTCCCGGATCG?
The complementary strand of DNA for the sequence AATGCTGATTCCCGGATCG would be TTACGACTAAGGGCCTAGC. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base in the original strand is replaced by its complementary base to form the new strand.
What gene DNA sequence encodes mvhtdaekaavsglw?
The gene DNA sequence that encodes the protein "mvhtdaekaavsglw" would be specific to the organism of interest. To determine the specific gene sequence, one would need to perform a database search using the protein sequence to identify the corresponding gene sequence. This can be done through tools like BLAST or by searching specific databases like NCBI.
