0
What else can I help you with?
One would expect in the structure of a DNA molecule thymine would always be paired to?
adenine.
What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg?
I though the question is asking the complimentary strand of the sequence. It would be TCCGGTAATCGGGATAAGCCCATATTTACC. Adenine pairs with thymine and guanine pair up cytosine by hydrogen bonds.
What are the nitrogenous pair combinations in dna?
In DNA, the nitrogenous base pairs are adenine (A) paired with thymine (T), and guanine (G) paired with cytosine (C). These base pairs are essential for maintaining the DNA double helix structure and are crucial for genetic information storage and replication.
What is the DNA sequence that is complementary to DNA strands of CGGCCTTCAATAGGTCCCAAA?
The complementary DNA sequence to CGGCCTTCAATAGGTCCCAAA is GCCGGAAGTTATCCAGGGTTT. In DNA, adenine pairs with thymine and guanine pairs with cytosine, so in the complementary sequence, each base is replaced by its complement.
What is the DNA instructions and make proteins?
A molecule of DNA is made of "base pairs"; there are four bases in DNA: Thymine (T), Adenine (A), Cytosine (C), and Guanine (G). In the DNA double-helix thymine and adenine are always paired, and cytosine and guanine are always paired. The sequence of base pairs on a gene are read by molecules in the cell and they serve as instruction to give to the ribosome; the ribosome then assembles the amino acid chain (a protein) based on the "instructions" that it reads from the DNA sequence.
What are the function of dI and sI register?
The SI (Source Index) and DI (Destination Index) registers are useful in repeated string operations, such as copy. The DS (Data Segment) register is paired up with SI and the ES (Extra Segment) register is paired up with DI.
One would expect in the structure of a DNA molecule thymine would always be paired to?
adenine.
Are the setae on an earthworm segment paired?
Yes, the setae on an earthworm segment are usually arranged in pairs, with each pair located on opposite sides of the segment. These setae help the earthworm grip the soil and aid in movement.
What kind of Nervous system does a Arthropods have?
An arthropod's nervous system is described as 'ladder-like' on their ventral surface or underside, with paired nerve ganglia on each segment, and their brains formed around the esophagus from fused segment nerve ganglia.
What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg?
I though the question is asking the complimentary strand of the sequence. It would be TCCGGTAATCGGGATAAGCCCATATTTACC. Adenine pairs with thymine and guanine pair up cytosine by hydrogen bonds.
Which describrs the correct pairing of dna bases?
(in apex 2.1.3) T with A, and C with G The DNA bases are paired as follows: Adenine is paired to Thymine Guanine is paired to Cytosine. This is the same for RNA except Adenine is paired to Uracil instead of Thymine.
What are the nitrogenous pair combinations in dna?
In DNA, the nitrogenous base pairs are adenine (A) paired with thymine (T), and guanine (G) paired with cytosine (C). These base pairs are essential for maintaining the DNA double helix structure and are crucial for genetic information storage and replication.
What is the DNA sequence that is complementary to DNA strands of CGGCCTTCAATAGGTCCCAAA?
The complementary DNA sequence to CGGCCTTCAATAGGTCCCAAA is GCCGGAAGTTATCCAGGGTTT. In DNA, adenine pairs with thymine and guanine pairs with cytosine, so in the complementary sequence, each base is replaced by its complement.
What would be the complementary dna for gac tga cga tta?
The complementary DNA sequence for ttcacgag would be aagtgctc. This is because "t" pairs up with "a" and "g" pairs up with "c."
Complementary dna sequence?
A complimentary DNA sequence is the genetic code on the partner strand that aligns with and corresponds to (matches) the code on the primary strand. Each nucleotide has a match, A matches T and C matches G, therefore the complimentary sequence for ATCGA is TAGCT.
What is the DNA instructions and make proteins?
A molecule of DNA is made of "base pairs"; there are four bases in DNA: Thymine (T), Adenine (A), Cytosine (C), and Guanine (G). In the DNA double-helix thymine and adenine are always paired, and cytosine and guanine are always paired. The sequence of base pairs on a gene are read by molecules in the cell and they serve as instruction to give to the ribosome; the ribosome then assembles the amino acid chain (a protein) based on the "instructions" that it reads from the DNA sequence.
Does a lamprey have a paired appendages vertebral column?
No a lamprey does not have paired appendages.
