The complementary DNA sequence for ttcacgag would be aagtgctc. This is because "t" pairs up with "a" and "g" pairs up with "c."
The complementary DNA strand would be AGC CTG GTA GCT. In DNA, adenine pairs with thymine and cytosine pairs with guanine. Therefore, the complementary strand is formed by replacing each base with its complementary base.
gac uau Gac uau GAC UAU
The DNA strand CAT-TAG would produce a complementary mRNA strand of GUA-AUC.
Ucg cga GAC UAU
If 5'- ATCAGACTCA -3' is the DNA template, 3'- UAGUCUGAGU -5' is the mRNA complement.Be careful: strands are always read 5' to 3'.
The complementary DNA strand would be AGC CTG GTA GCT. In DNA, adenine pairs with thymine and cytosine pairs with guanine. Therefore, the complementary strand is formed by replacing each base with its complementary base.
To transcribe DNA to messenger RNA, you need to replace each DNA base with its RNA complement: G in DNA is transcribed to C in mRNA, C to G, A to U (uracil), and T to A. Therefore, the DNA sequence ccg atc gac cga would be transcribed to GGC UAG CUG GCU in mRNA.
gac uau Gac uau GAC UAU
The DNA strand CAT-TAG would produce a complementary mRNA strand of GUA-AUC.
Ucg cga GAC UAU
The complementary base of A is T, and the complementary base of G is C. So if there is an T the complementary would be A, and if there is a C the complementary would be a G and so on. Therefore the complementary strand would be: G A A T C C G A A T G G T.
If 5'- ATCAGACTCA -3' is the DNA template, 3'- UAGUCUGAGU -5' is the mRNA complement.Be careful: strands are always read 5' to 3'.
Oh, dude, it's like DNA and mRNA are like besties, you know? So, if DNA has CTG ATC, mRNA would have GAC UAG. It's like they're mirror images, but not really, because they're still unique in their own ways. So, yeah, that's how the complementary segment of mRNA would look like for that DNA sequence.
Gca-tat gca ta The answer is AGC CT cat gt
There is not really such a thing as a mirror image of DNA in nature. DNA polymerase may be the "molecule" that you are thinking of, it is an enzyme that replicates DNA. When the polymerase makes a new strand of DNA, it uses an existing strand of DNA as a template. The new strand of DNA is not in fact a mirror image of the template strand, but it is the closest thing possible. The new strand is called a complementary strand, not a mirror image.Existing DNA (template for polymerase): ATC TGA CCG GAC TAG GGTNew strand (made by polymerase): TAG ACT GGC CTG ATC CCAAlternatively, by mirror image of DNA you may be thinking of RNA, a ribonucleotide that is made by RNA polymerase. The process is similar to that described above, but the new complementary strand is made out of ribonucleic acid rather than deoxyribonucleic acid.
The mRNA strand for the given DNA sequence "ggctatatcctgcgctatacgcta" would be "ccgua.uauggcg..uauacgua" after transcription. This is achieved by replacing each DNA nucleotide with its complementary RNA nucleotide (A-U, T-A, C-G, G-C).
The mRNA sequence which is complementary to the DNA sequence 5' - GAC ATG GAA - 3' is:3' - CUG UAC CUU - 5'