0
Adenine pairs with Guanine, Thaimine pairs with Cytosine.
Wiki User
∙ 12y ago
Add your answer:
Earn +20 pts
What is a base that forms with thymine?
DNA!! the matching strands of rna form dna..
Does DNA Ligase restore the base sequence in a DNA molecule when it gets altered?
DNA ligase does not alter base sequence. It is an enzyme that joins a 3'-OH to a 5'-phosphate group.Now what you might have been thinking of, is DNA ligase's role in helping to reverse DNA damage.When there is a mismatch, an enzyme complex will use methylation, among other signals, to choose a strand to take a chunk out of, leaving the other as the template.Then DNA polymerase does its magic, then ligase seals the newly created, matching strand in place.
How is complementary base pairing different when pairing DNA to DNA than pairing DNA to mrna?
So essentially the difference is that in DNA-DNA base pairs thymine bonds with adenine while in DNA-RNA base pairs thymine bonds to uracil.
Which nitrogen base of DNA cahnges?
The nitrogen base thymine in DNA is replaced by the nitrogen base uracil in RNA.
Why DNA is called acidic but it is attached to base?
DNA is deoxyribonucleic acid why DNA is called acid but it contains nitrogenous base.
What is a base that forms with thymine?
DNA!! the matching strands of rna form dna..
How is shotgun sequencing similar to doing a jigsaw puzzle?
Because instead of matching shapes your matching dna base sequences
The two main purposes for analyzing vntr dna from dna fingerprints are matching tissues and inheritance?
The two main purposes for analyzing VNTR from DNA fingerprints are matching tissues and inheritance - This is True
During DNA replication a DNA strand has the bases Write the matching rna strand DNA ctagctagtctagtcctgatac RNA?
gaucgaucacucaggacuaug
What is is the correct base pair matching of DNA?
The nucleotide base pairs are: A-T C-G Thats Adenine to Thymine and Cytosine to Guanine During DNA transcription Uracil bonds with Adenine instead of Thymine, although when A-U is bonded it would technically be an RNA molecule
What is the process that involves making RNA to DNA?
It is actually a process that turns DNA to RNA through transcription. This process unravels the DNA strand, and through complementary base pairing with bases CGAU matching with GCUA, two new daughter strands are created that are now called RNA or ribonucleic acid.
Does DNA Ligase restore the base sequence in a DNA molecule when it gets altered?
DNA ligase does not alter base sequence. It is an enzyme that joins a 3'-OH to a 5'-phosphate group.Now what you might have been thinking of, is DNA ligase's role in helping to reverse DNA damage.When there is a mismatch, an enzyme complex will use methylation, among other signals, to choose a strand to take a chunk out of, leaving the other as the template.Then DNA polymerase does its magic, then ligase seals the newly created, matching strand in place.
What do DNA have and RNA not?
RNA has the base uracil which replaces the thymine base of DNA.
What do DNA and RNA have?
RNA has the base uracil which replaces the thymine base of DNA.
What sequence of DNA base bonds with DNA base sequence ATGT?
TACA
What base is found on DNA but not DNA?
Exocytozine
What base is found in DNA but not in DNA?
Thymine
