answersLogoWhite

0

Adenine pairs with Guanine, Thaimine pairs with Cytosine.

User Avatar

Wiki User

14y ago

What else can I help you with?

Continue Learning about Natural Sciences

What is a base that forms with thymine?

DNA!! the matching strands of rna form dna..


What is the matching DNA strand called?

The matching DNA strand is called the complementary strand. In DNA, the bases pair specifically: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). This complementary base pairing is essential for the structure of DNA and plays a crucial role in processes like DNA replication and transcription.


What is another example of a template DNA code that is at least four base pairs long. Then give its matching complementary DNA and mRNA codes?

An example of a template DNA code that is four base pairs long is 5'-ATGC-3'. The matching complementary DNA sequence would be 3'-TACG-5'. The corresponding mRNA code, transcribed from the template strand, would be 5'-AUGC-3'.


Does DNA Ligase restore the base sequence in a DNA molecule when it gets altered?

DNA ligase does not alter base sequence. It is an enzyme that joins a 3'-OH to a 5'-phosphate group.Now what you might have been thinking of, is DNA ligase's role in helping to reverse DNA damage.When there is a mismatch, an enzyme complex will use methylation, among other signals, to choose a strand to take a chunk out of, leaving the other as the template.Then DNA polymerase does its magic, then ligase seals the newly created, matching strand in place.


What does the term complementary mean when referring to DNA replication?

In DNA replication, the term complementary refers to the matching base pairing between nucleotides on the two strands of the DNA double helix. Adenine pairs with thymine and guanine pairs with cytosine, creating two identical daughter strands during replication.

Related Questions

What is the matching base code to ATCGA?

The matching base code to the DNA sequence "ATCGA" is "TAGCT." In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base in the original sequence has a complementary base in the matching sequence.


What is the 2nd stand matching DNA?

The 2nd strand matching DNA refers to the strand that can pair with the original DNA sequence through complementary base pairing. In DNA replication, this matching strand is synthesized by DNA polymerase according to the sequence on the original template strand.


What is a base that forms with thymine?

DNA!! the matching strands of rna form dna..


How does the process of DNA replication ensure accurate base pairing?

During DNA replication, the enzyme DNA polymerase helps ensure accurate base pairing by matching each nucleotide with its complementary base. This process helps maintain the genetic code's accuracy and prevents errors in the DNA sequence.


How does base pairing contribute to the accuracy of DNA replication?

Base pairing in DNA replication ensures that the correct nucleotides are added to the new DNA strand, matching with their complementary bases. This contributes to the accuracy of DNA replication by reducing the chances of errors or mutations in the newly synthesized DNA strand.


What is the matching DNA strand called?

The matching DNA strand is called the complementary strand. In DNA, the bases pair specifically: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). This complementary base pairing is essential for the structure of DNA and plays a crucial role in processes like DNA replication and transcription.


What is another example of a template DNA code that is at least four base pairs long. Then give its matching complementary DNA and mRNA codes?

An example of a template DNA code that is four base pairs long is 5'-ATGC-3'. The matching complementary DNA sequence would be 3'-TACG-5'. The corresponding mRNA code, transcribed from the template strand, would be 5'-AUGC-3'.


The nucleotide base sequence of a strand of DNA is TAC-CGG-AGT. What is the sequence of the complementary DNA strand?

The complementary DNA strand to TAC-CGG-AGT is ATG-GCC-TCA. In DNA, adenine pairs with thymine (A-T) and cytosine pairs with guanine (C-G), so the complementary strand is created by matching these base pairs.


During DNA replication a DNA strand has the bases Write the matching rna strand DNA ctagctagtctagtcctgatac RNA?

gaucgaucacucaggacuaug


The two main purposes for analyzing vntr dna from dna fingerprints are matching tissues and inheritance?

Analyzing VNTR DNA from DNA fingerprints is primarily used for identifying individuals and establishing biological relationships. This can be helpful in criminal investigations, paternity testing, and identifying victims in mass disasters. It is not typically used for matching tissues for transplantation.


What base does RNA have that DNA does not have?

RNA has the base uracil that DNA does not have.


What is the process that involves making RNA to DNA?

It is actually a process that turns DNA to RNA through transcription. This process unravels the DNA strand, and through complementary base pairing with bases CGAU matching with GCUA, two new daughter strands are created that are now called RNA or ribonucleic acid.