0
What else can I help you with?
What is a base that forms with thymine?
DNA!! the matching strands of rna form dna..
Does DNA Ligase restore the base sequence in a DNA molecule when it gets altered?
DNA ligase does not alter base sequence. It is an enzyme that joins a 3'-OH to a 5'-phosphate group.Now what you might have been thinking of, is DNA ligase's role in helping to reverse DNA damage.When there is a mismatch, an enzyme complex will use methylation, among other signals, to choose a strand to take a chunk out of, leaving the other as the template.Then DNA polymerase does its magic, then ligase seals the newly created, matching strand in place.
What does the term complementary mean when referring to DNA replication?
In DNA replication, the term complementary refers to the matching base pairing between nucleotides on the two strands of the DNA double helix. Adenine pairs with thymine and guanine pairs with cytosine, creating two identical daughter strands during replication.
Which nitrogen base of DNA cahnges?
The nitrogen base thymine in DNA is replaced by the nitrogen base uracil in RNA.
Why DNA is called acidic but it is attached to base?
DNA is deoxyribonucleic acid why DNA is called acid but it contains nitrogenous base.
What is the 2nd stand matching DNA?
The 2nd strand matching DNA refers to the strand that can pair with the original DNA sequence through complementary base pairing. In DNA replication, this matching strand is synthesized by DNA polymerase according to the sequence on the original template strand.
What is a base that forms with thymine?
DNA!! the matching strands of rna form dna..
How does the process of DNA replication ensure accurate base pairing?
During DNA replication, the enzyme DNA polymerase helps ensure accurate base pairing by matching each nucleotide with its complementary base. This process helps maintain the genetic code's accuracy and prevents errors in the DNA sequence.
How does base pairing contribute to the accuracy of DNA replication?
Base pairing in DNA replication ensures that the correct nucleotides are added to the new DNA strand, matching with their complementary bases. This contributes to the accuracy of DNA replication by reducing the chances of errors or mutations in the newly synthesized DNA strand.
The nucleotide base sequence of a strand of DNA is TAC-CGG-AGT. What is the sequence of the complementary DNA strand?
The complementary DNA strand to TAC-CGG-AGT is ATG-GCC-TCA. In DNA, adenine pairs with thymine (A-T) and cytosine pairs with guanine (C-G), so the complementary strand is created by matching these base pairs.
During DNA replication a DNA strand has the bases Write the matching rna strand DNA ctagctagtctagtcctgatac RNA?
gaucgaucacucaggacuaug
What base does RNA have that DNA does not have?
RNA has the base uracil that DNA does not have.
The two main purposes for analyzing vntr dna from dna fingerprints are matching tissues and inheritance?
Analyzing VNTR DNA from DNA fingerprints is primarily used for identifying individuals and establishing biological relationships. This can be helpful in criminal investigations, paternity testing, and identifying victims in mass disasters. It is not typically used for matching tissues for transplantation.
What is the process that involves making RNA to DNA?
It is actually a process that turns DNA to RNA through transcription. This process unravels the DNA strand, and through complementary base pairing with bases CGAU matching with GCUA, two new daughter strands are created that are now called RNA or ribonucleic acid.
What base does RNA have that DNA doesn't?
RNA has the base uracil that DNA does not have.
What is the significance of complementary base pairing in DNA replication and transcription?
Complementary base pairing is crucial in DNA replication and transcription because it ensures accurate copying of genetic information. During replication, the matching of bases (A with T, and C with G) allows for the faithful duplication of the DNA molecule. In transcription, base pairing helps in the synthesis of messenger RNA from the DNA template, enabling the correct transfer of genetic instructions for protein synthesis. Overall, complementary base pairing is essential for maintaining the integrity and fidelity of genetic information in living organisms.
Does DNA Ligase restore the base sequence in a DNA molecule when it gets altered?
DNA ligase does not alter base sequence. It is an enzyme that joins a 3'-OH to a 5'-phosphate group.Now what you might have been thinking of, is DNA ligase's role in helping to reverse DNA damage.When there is a mismatch, an enzyme complex will use methylation, among other signals, to choose a strand to take a chunk out of, leaving the other as the template.Then DNA polymerase does its magic, then ligase seals the newly created, matching strand in place.
