0
Ggc tct aac
What else can I help you with?
What does the presence of the nucleotides adenine (A) and thymine (T) in a DNA sequence signify?
The presence of the nucleotides adenine (A) and thymine (T) in a DNA sequence signifies a complementary base pairing, where A always pairs with T.
What does it mean to say DNA polymerase reads a template strand to make the complementary strand?
During DNA replication, the enzyme DNA polymerase catalyses the formation of new strands of DNA, using the old strands as models. DNA has a double-helix structure, with two strands forming each helix. Each strand is made up of DNA nucleotides, with the genetic information encoded in the sequence of different nucleotides (different nucleotides are distinguished by molecules called 'bases' attached to them, so the sequence of nucleotides is known as the 'base sequence'). The base sequence of one strand is complementary to that of its' neighbour - the base A binds with T, and C with G, so if one strand had the sequence ATTACA, the base sequence of the complementary strand would be TAATGT. When DNA polymerase creates a new DNA strand, it does so by matching nucleotides to the base sequence of one of the strands - the template strand. New nucleotides are brought in, which match the template in a complementary fashion (ie. A-T, C-G), and join to become one new strand. This new strand is complementary to the template.
What is the enzyme that is responsible for replicating molecules of DNA by attaching complementary bases in the correct sequence?
DNA polymerase is the enzyme responsible for replicating DNA by adding complementary nucleotides in the correct sequence during DNA synthesis.
What picks up information from DNA?
RNA polymerase picks up information from DNA by reading the sequence of nucleotides and transcribing it into a complementary RNA sequence during the process of transcription.
What is three nucleotides on transfer RNA that are complementary to the three nucleotides on messenger RNA?
There are four nucleotides in tRNA that are complementary to the four nucleotides on mRNA. Both types of RNA contain the nucleotides adenine, guanine, cytosine, and uracil. In both types of RNA adenine is complementary to uracil, and cytosine is complementary to guanine.
Complementary nucleotides to a codon?
Anticodon
What sequence is complementary to aggtac?
The complementary sequence to aggtac would be tccatg. T is complementary to A and C is complementary to G.
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."
What has an anticodon region?
Anticodons are a sequence of three adjacent nucleotides located on one end of transfer RNA. It bounds to the complementary coding triplet of nucleotides in messenger RNA during translation phase of protein synthesis.
What connects Rna nucleotides to dNA during transcription?
During transcription, RNA polymerase catalyzes the synthesis of an RNA molecule by base-pairing complementary RNA nucleotides with the DNA template strand. This complementary base pairing allows the RNA nucleotides to be connected to the DNA template, forming a growing strand of RNA that is identical in sequence to the non-template DNA strand.
What is the nucleotide sequence of the complementary strand of the dna molecule t t c g a a t t g c?
The sequence of nucleotides of the complementary strand will be the nucleotides which bind to the nucleotides of the template. In DNA, adenine binds to thymine and cytosine binds to guanine. The complementary strand will therefore have an adenine where the template strand has a thymine, a guanine where the template has a cytosine, etc. For example: If the template strand is ATG-GGC-CTA-GCT Then the complementary strand would be TAC-CCG-GAT-CGA
Do nucleotides only pair with certain other nucleotides based on their properties?
Yes, nucleotides pair with specific complementary nucleotides based on their chemical properties.
