Ggc tct aac
The presence of the nucleotides adenine (A) and thymine (T) in a DNA sequence signifies a complementary base pairing, where A always pairs with T.
During DNA replication, the enzyme DNA polymerase catalyses the formation of new strands of DNA, using the old strands as models. DNA has a double-helix structure, with two strands forming each helix. Each strand is made up of DNA nucleotides, with the genetic information encoded in the sequence of different nucleotides (different nucleotides are distinguished by molecules called 'bases' attached to them, so the sequence of nucleotides is known as the 'base sequence'). The base sequence of one strand is complementary to that of its' neighbour - the base A binds with T, and C with G, so if one strand had the sequence ATTACA, the base sequence of the complementary strand would be TAATGT. When DNA polymerase creates a new DNA strand, it does so by matching nucleotides to the base sequence of one of the strands - the template strand. New nucleotides are brought in, which match the template in a complementary fashion (ie. A-T, C-G), and join to become one new strand. This new strand is complementary to the template.
DNA polymerase is the enzyme responsible for replicating DNA by adding complementary nucleotides in the correct sequence during DNA synthesis.
RNA polymerase picks up information from DNA by reading the sequence of nucleotides and transcribing it into a complementary RNA sequence during the process of transcription.
The genetic code on the complementary strand refers to the sequence of nucleotides that pairs with a corresponding sequence on the original DNA strand. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, if the original strand has a sequence like ACGT, the complementary strand would have the sequence TGCA. This complementary base pairing is crucial for DNA replication and transcription processes.
There are four nucleotides in tRNA that are complementary to the four nucleotides on mRNA. Both types of RNA contain the nucleotides adenine, guanine, cytosine, and uracil. In both types of RNA adenine is complementary to uracil, and cytosine is complementary to guanine.
Anticodon
The nucleotide sequence of the mRNA strand is determined by the DNA template strand during transcription. If the DNA template sequence is, for example, 3'-ATCGTAGC-5', the corresponding mRNA sequence synthesized would be 5'-UAGCAUCG-3'. The mRNA sequence consists of complementary RNA nucleotides, where adenine (A) pairs with uracil (U) and cytosine (C) pairs with guanine (G).
Anticodons are a sequence of three adjacent nucleotides located on one end of transfer RNA. It bounds to the complementary coding triplet of nucleotides in messenger RNA during translation phase of protein synthesis.
During transcription, RNA polymerase catalyzes the synthesis of an RNA molecule by base-pairing complementary RNA nucleotides with the DNA template strand. This complementary base pairing allows the RNA nucleotides to be connected to the DNA template, forming a growing strand of RNA that is identical in sequence to the non-template DNA strand.
The complementary sequence to aggtac would be tccatg. T is complementary to A and C is complementary to G.
The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."