0
Want this question answered?
Be notified when an answer is posted
Add your answer:
Earn +20 pts
When DNA replicates what are the new DNA made of?
its made of DNA. Replication just doubles the DNA, just like when bacteria or humans replicate.. the new human is .. well made of human.... It is opposite and anti-parallel.... 5-AATGTC-3 Original strand 3-TTACAG-5 new strand Each new molecule will have 1 original strand, and 1 daughter/newly synthesized strand. DNA replication results in DNA DNA transcription results in a strand of RNA
What is the difference between a DNA molecule and RNA molecule?
There are some differences between DNA and RNA 1) RNA is usually single stranded whereas DNA is double stranded 2) DNA ( Deoxyribosenucleic acid) has one less oxygen atom than RNA (Ribosenucleic acid) 3) The nucleotides in DNA differ from an RNA strand as DNA contains a Thymine nucleotide and RNA contains an Uracil nucleotide.
How can you describe how DNA makes a copy of itself?
To reproduce a cell must copy and transmit its genetic information (DNA) to all of its progeny. Two strands of DNA are obtained from one, having produced tow daughter molecules which are identical to one another and to the parent molecule.
What is an explanation of how DNA is replicated?
during DNA replication, the DNA molecule separates into two strands, then produces two new complementary strands following the rules of base pairing. Each strand of double helix of DNA serves as a template, or model, for the new strand. <3 , (:
Match this sequence of DNA 5-caagtggaat-3 with its complementary DNA strand?
3-gttcacctta-5
DNA molecule antiparallel Why?
The DNA molecule is anti-parallel. This is because the two strands are the opposite of one another, such that if one strand has the base sequence ATC, the opposite strand would have the base sequence TAG.
When DNA replicates what are the new DNA made of?
its made of DNA. Replication just doubles the DNA, just like when bacteria or humans replicate.. the new human is .. well made of human.... It is opposite and anti-parallel.... 5-AATGTC-3 Original strand 3-TTACAG-5 new strand Each new molecule will have 1 original strand, and 1 daughter/newly synthesized strand. DNA replication results in DNA DNA transcription results in a strand of RNA
What is an end replication problem?
The two strands of a DNA molecule are antiparallel to one another (the backbone of one strand runs from 5'-3' while the complimentary strand runs 3'-5'). Unfortunately, DNA polymerase, the enzyme responsible for replicating DNA, can only make DNA in a 5'-3' direction (and read DNA in the 3'-5' direction). Also, it needs a "primer" to give it a place to bind and start replication. So this creates a problem when synthesizing the 3'-5' stand because your enzyme will only synthesize 5'-3'. During replication this is solved by synthesizing small pieces of DNA ahead of the replication fork on the 5'-3' mother strand. Thus we have one daughter strand which is synthesized as a continuous piece of DNA (called the leading strand) and one daughter strand which is synthesized in small, discontinuous pieces (called the lagging strand). However, at the extreme end of the DNA, we run into another problem. The leading stand can be made to the very end, but the lagging strand cannot because you need the RNA primer upstream to begin each piece of the lagging strand DNA but at the end of the DNA there is nothing for this piece to attach to. Thus, the last section of the lagging strand cannot be synthesized and after several rounds of DNA replication, the DNA molecule gets smaller and smaller. This is "the end of replication problem" and it is solved by putting a DNA cap on the ends of DNA called a telomere which does not code for any protein, thus when this information is lost it does not have severe consequences for the cell.
What does semi-conservative mean regard to DNA replication?
replicated DNA is made of one old strand and one new strand.
What is the difference between a DNA molecule and RNA molecule?
There are some differences between DNA and RNA 1) RNA is usually single stranded whereas DNA is double stranded 2) DNA ( Deoxyribosenucleic acid) has one less oxygen atom than RNA (Ribosenucleic acid) 3) The nucleotides in DNA differ from an RNA strand as DNA contains a Thymine nucleotide and RNA contains an Uracil nucleotide.
How can you describe how DNA makes a copy of itself?
To reproduce a cell must copy and transmit its genetic information (DNA) to all of its progeny. Two strands of DNA are obtained from one, having produced tow daughter molecules which are identical to one another and to the parent molecule.
Which enzymes catalyzes the elongation of a new DNA strand?
DNA polymerase catalyzes the reactions that are responsible for synthesizing new DNA strands in the 5' to 3' direction. The parent DNA strand is read in the 3' to 5' direction but the daughter strand is extended in the opposite direction.
In which direction does RNA polymerase read a DNA strand?
The correct answer is: RNA is synthesized by RNA polymerase that reads one strand of DNA. RNA polymerase reads DNA 3' to 5'. When RNA is made, it is made 5' to 3'. Most polymerases have the 3' to 5' "reading" activity. The created RNA strand is identical to the coding strand of DNA, which is also in the orientation of 5' to 3'.
What is an explanation of how DNA is replicated?
during DNA replication, the DNA molecule separates into two strands, then produces two new complementary strands following the rules of base pairing. Each strand of double helix of DNA serves as a template, or model, for the new strand. <3 , (:
What is the non template strand?
The difference between the coding strand and the template strand is the coding strand is the strand which contains the coding genes, i.e. the one in which the RNA polymerase reads and transcribes into mRNA. It must have the promoter sequence in the correct orientation for transcription, as follows:5`-TATAATGCGCGCGCGCGCGCGCGC-3`3`-ATATTACGCGCGCGCGCGCGCGCG-5`In this sequence, the top strand is the coding strand, because it contains the promoter (TATAAT) in the correct orientation.However, when transcribed, the mRNA will be as follows:5`-GCGCGCGCGCGCGCGCGCGC-3`This is because the polymerase transcribes from the template strand, on the opposide side to the coding strand, to make it in the same orientation as the coding strand.I hope I have explained it enough for people to understand, however if I haven't please read this article I found which explains it thoroughly:http://www.bio.net/bionet/mm/bioforum/1994-May/008821.html
Complementary strand of dna AAT?
Answer and Explanation: For the sequence 5′-GATTACA-3′, the complementary DNA strand would be 3′-CTAATGT-5′. Often, DNA strands are written in the 5′ to 3′ direction, so the complementary strand would be 5′-TGTAATC-3′ when written 5′ to 3′. What is complementary to mRNA?
Would 5' atgctatcattgaccttgagttattaa -3' be a strand of DNA or RNA?
This has to be a strand of DNA because RNA does not have Thymine (T), instead it has Uracil (U).Thus, if this strand were RNA it would read:5' augcuaucauugaccuugaguuauuaa 3'
