0
What sequence of bases would you expect to see paired with a segment of DNA with base sequence acgtcg?
Wiki User
∙ 13y ago
In DNA, the sequence of bases that would pair with GTACG would be CATGC. In RNA, the sequence of bases that would pair with GTACG would be CAUGC, because in RNA, uracil (U) replaces thymine (T).
Wiki User
∙ 12y ago
Wiki User
∙ 9y agoThe sequences of bases that would be expected to be paired with a segment of DNA with the following base sequence a-c-g-t-c-g would be t-g-c-a-g-c. This is because of the pairs of bases.
Wiki User
∙ 13y agoTGCAGC would be paired with the sequence in question
Wiki User
∙ 7y agoIf the segment is DNA, its sequence will be: AATGCG. On the other hand, if the segment is mRNA it shall be: AAUGCG.
Wiki User
∙ 8y agoTGC AGA matches with ACG TCG.
Wiki User
∙ 10y agoaatgcg
Wiki User
∙ 8y agoTGCAGC
Add your answer:
Earn +20 pts
What is a characteristic of nucleic acids in which the sequence of bases on one strand is paired to the sequence of bases on the other?
Complementary Base- pairs
One would expect in the structure of a DNA molecule thymine would always be paired to?
adenine.
What are the nitrogenous pair combinations in dna?
The pairing sequence is: (A) Adenine - (T) Thymine (C) Cytosine-(G) Guainine
What is the DNA sequence that is complementary to DNA strands of CGGCCTTCAATAGGTCCCAAA?
Adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). I remember this because A paired with T spells AT. The complementary DNA sequence to TGCCAT is ACGGTA.
What is the DNA instructions and make proteins?
A molecule of DNA is made of "base pairs"; there are four bases in DNA: Thymine (T), Adenine (A), Cytosine (C), and Guanine (G). In the DNA double-helix thymine and adenine are always paired, and cytosine and guanine are always paired. The sequence of base pairs on a gene are read by molecules in the cell and they serve as instruction to give to the ribosome; the ribosome then assembles the amino acid chain (a protein) based on the "instructions" that it reads from the DNA sequence.
Are the setae on an earthworm segment paired?
Yes on lateral and ventral surfaces.
What is a characteristic of nucleic acids in which the sequence of bases on one strand is paired to the sequence of bases on the other?
Complementary Base- pairs
What are the function of dI and sI register?
The SI (Source Index) and DI (Destination Index) registers are useful in repeated string operations, such as copy. The DS (Data Segment) register is paired up with SI and the ES (Extra Segment) register is paired up with DI.
One would expect in the structure of a DNA molecule thymine would always be paired to?
adenine.
What are the nitrogenous pair combinations in dna?
The pairing sequence is: (A) Adenine - (T) Thymine (C) Cytosine-(G) Guainine
Which describrs the correct pairing of dna bases?
(in apex 2.1.3) T with A, and C with G The DNA bases are paired as follows: Adenine is paired to Thymine Guanine is paired to Cytosine. This is the same for RNA except Adenine is paired to Uracil instead of Thymine.
What kind of Nervous system does a Arthropods have?
An arthropod's nervous system is described as 'ladder-like' on their ventral surface or underside, with paired nerve ganglia on each segment, and their brains formed around the esophagus from fused segment nerve ganglia.
What is the DNA sequence that is complementary to DNA strands of CGGCCTTCAATAGGTCCCAAA?
Adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). I remember this because A paired with T spells AT. The complementary DNA sequence to TGCCAT is ACGGTA.
According to chargaffs rules which nucleotide is always paired with adenine in a DNA molecule?
Chargaff's rules stated that the number of adenine units in a DNA segment were equal to the number of thymine units.
What would be the complementary dna for gac tga cga tta?
The complementary DNA sequence for ttcacgag would be aagtgctc. This is because "t" pairs up with "a" and "g" pairs up with "c."
What is the DNA instructions and make proteins?
A molecule of DNA is made of "base pairs"; there are four bases in DNA: Thymine (T), Adenine (A), Cytosine (C), and Guanine (G). In the DNA double-helix thymine and adenine are always paired, and cytosine and guanine are always paired. The sequence of base pairs on a gene are read by molecules in the cell and they serve as instruction to give to the ribosome; the ribosome then assembles the amino acid chain (a protein) based on the "instructions" that it reads from the DNA sequence.
What is the complementary DNA sequence to AATCCGAT is?
In the cases of MRNA and DNA there are differences in the base pairs that make up the two compounds. In a situation in which Adenosine, Thymine, and Cytosine would need to be paired between DNA and RNA Guanine would be used on the RNA side.
