0
What else can I help you with?
DNA strand that would replicate tcgagaatctcgatt?
The complimentary DNA strand would be AGCTCTTAGAGCTAA.
Which strand would be the template for the leading strand?
The leading strand would utilize the 3' to 5' template DNA strand as a guide for continuous synthesis of complementary DNA in the 5' to 3' direction by DNA polymerase during DNA replication.
If you had a small single strand of DNA with the nucleotide sequence cagtact what would the sequence be for the other DNA strand?
The complementary DNA strand would be GTACTGA. In DNA, adenine pairs with thymine and cytosine pairs with guanine.
The complimentary strand or matchig strand of DNA for tagtca would be?
It would be ATCAGT. A=T T=A G=C C=G for all the DNA sequences the complementary strand would be the opposite.
What would be the strand of complementary DNA produced by the strand of DNA shown below TCG AAGAsk us anything?
The complementary DNA strand produced from the given DNA strand TCG AAG would be AGC TTC. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base on the original strand is matched with its complementary base to form the new strand.
What strand of DNA would be prod from the template strand of DNA shown below?
The complementary strand of DNA to the template strand TACGGCTA would be ATGCCGAT.
DNA strand that would replicate tcgagaatctcgatt?
The complimentary DNA strand would be AGCTCTTAGAGCTAA.
What strand of DNA would be would be produced from the template strand of DNA shown?
Ttg ga
What bases would match up to form a matching DNA strand from this pattern?
A pairs with T, C pairs with G. So the matching bases for a DNA strand with the pattern GATC would be CTAG.
When a strand of DNA is ATCG what would the complementary pairings be for the replicated strand of DNA?
TAGC.
What complementary strand of DNA would be produced from the DNA strand cgt ta?
The complementary strand of DNA to cgtta would be gcaat. This is because in DNA, cytosine pairs with guanine and thymine pairs with adenine.
Could DNA be amplified with only one primer?
No because it changes letters so the primer will not be the correct match. They have to be different.For example, the original DNA strand is AATGCGTACTAGCTAGTCTTAGTC and the primer is TTACGC. There is no other match to the DNA strand so a new one will have to be used.
If you were to stretch the DNA from a cell out, how long would the strand be?
If you were to stretch the DNA from a cell out, the strand would be about 6 feet long.
Which strand would be the template for the leading strand?
The leading strand would utilize the 3' to 5' template DNA strand as a guide for continuous synthesis of complementary DNA in the 5' to 3' direction by DNA polymerase during DNA replication.
What strand of DNA of would be produced from the template strand of DNA?
AAC CT would produce TTG GA The coding strand is the DNA strand that has the same base sequence as the RNA transcript. It contains codons, and the non-coding strand has anti-codons instead.
If you had a small single strand of DNA with the nucleotide sequence cagtact what would the sequence be for the other DNA strand?
The complementary DNA strand would be GTACTGA. In DNA, adenine pairs with thymine and cytosine pairs with guanine.
The complimentary strand or matchig strand of DNA for tagtca would be?
It would be ATCAGT. A=T T=A G=C C=G for all the DNA sequences the complementary strand would be the opposite.
