0
The DNA strand, AGGCTTGCAG.
Wiki User
∙ 14y ago
Add your answer:
Earn +20 pts
DNA strand that would replicate tcgagaatctcgatt?
The complimentary DNA strand would be AGCTCTTAGAGCTAA.
Match this sequence of DNA 5-caagtggaat-3 with its complementary DNA strand?
3-gttcacctta-5
The complimentary strand or matchig strand of DNA for tagtca would be?
It would be ATCAGT. A=T T=A G=C C=G for all the DNA sequences the complementary strand would be the opposite.
If one strand of DNA has the following base cggatc what would the completary strand of DNA have?
A=T G=C it would be gcctag
What would be the consequence for DNA synthesis if DNA ligase were defective?
Lagging strand synthesis would be incomplete; leading strand synthesis would be unaffected.
DNA strand that would replicate tcgagaatctcgatt?
The complimentary DNA strand would be AGCTCTTAGAGCTAA.
What bases would match up to form a matching DNA strand from this pattern?
THYMINE-ADENINE CYTOSINE-GUANINE
What strand of DNA would be would be produced from the template strand of DNA shown?
Ttg ga
Match this sequence of DNA 5-caagtggaat-3 with its complementary DNA strand?
3-gttcacctta-5
When a strand of DNA is ATCG what would the complementary pairings be for the replicated strand of DNA?
TAGC.
What is the name of the enzyme that match the DNA bases?
DNA polymerase matches the bases on the parent strand.
Could DNA be amplified with only one primer?
No because it changes letters so the primer will not be the correct match. They have to be different.For example, the original DNA strand is AATGCGTACTAGCTAGTCTTAGTC and the primer is TTACGC. There is no other match to the DNA strand so a new one will have to be used.
What strand of DNA of would be produced from the template strand of DNA?
AAC CT would produce TTG GA The coding strand is the DNA strand that has the same base sequence as the RNA transcript. It contains codons, and the non-coding strand has anti-codons instead.
The complimentary strand or matchig strand of DNA for tagtca would be?
It would be ATCAGT. A=T T=A G=C C=G for all the DNA sequences the complementary strand would be the opposite.
If one strand of DNA has the following base cggatc what would the completary strand of DNA have?
A=T G=C it would be gcctag
What would be the consequence for DNA synthesis if DNA ligase were defective?
Lagging strand synthesis would be incomplete; leading strand synthesis would be unaffected.
What is the strand?
The template strand, if reffering to DNA, is the strand of the DNA that is copied to make more DNA.
