0
they would have 3' and 5' at the same end
What else can I help you with?
What would the end of the double helix look like if the strands were parallel?
If the strands of the double helix were parallel, the end would appear as two straight lines running side by side, rather than twisting around each other. This configuration would not allow for the hydrogen bonding between the bases that stabilize the structure of the double helix in its normal form.
What is the moleculer shape of dna?
DNA molecule is shaped like a spiral staircase and is composed of two parallel strands of linked subunits.
What happens If all of the hydrogen bonds in a DNA molecule were to break?
If all hydrogen bonds in a DNA molecule were to break, the double helix structure of DNA would unwind and separate into two single strands. This would disrupt the genetic information stored in the DNA molecule, preventing normal cellular functions such as replication and transcription. Ultimately, this could lead to genetic mutations and cell death.
How would you describe the shape of DNA?
DNA has a double helix shape, resembling a twisted ladder. It consists of two strands that wind around each other, forming a structure that is stable and can store genetic information. Each strand is made up of nucleotides containing a sugar-phosphate backbone and nitrogenous bases.
How many strands of nucleotides are in a DNA molecule?
There are two strands of DNA in a DNA double helix, each consisting of many nucleotide subunits. They are like building blocks that make up the DNA molecule, which would then be like a block tower. A 'strand of nucleotides' as you put it would basically be a DNA molecule (if they are deoxyribose nucleotides) or if they are ribose nucleotides, they would be a RNA molecule. DNA can come in double stranded helices (most of the time) or can be single stranded (as in some viruses).
What type of bonding holds the two strands of DNA together and why is this important?
hydrogen bonding between the two bases present on two strands of dna hold the two strands. If there was no hydrogen bonding then doublex helix structure of dna would not be possible
How would you describe the appearance of DNA molecule?
DNA stands for deoxiribonucliec acid and is shown in the form of a double helix. DNA particles themselves are two small for the naked eye to see but forms of DNA are things such as: hair strands, Nail clippings, fingerprints, skin cells, saliva, ect. basically anything that is part of your body.
What bonds do helicase and polymerase enzymes break?
Helicase enzyme breaks hydrogen bonds between base pairs in DNA strands to unwind the double helix structure. Polymerase enzyme breaks the bonds between nucleotides in the DNA strand being replicated, allowing for the addition of new nucleotides during DNA replication.
What does a DNA nucleotide look like?
TCCAAGAACCTACATGTTCGCGTGTTCAGCGTCCATTTCAGTATTTAGCATAAATTTGAAGAGCCGAATGGCAGTTTTGGGAGGGACACGTTGTTTTAAAAGAAGCCTTCACGAAATTGTGACCGGTCTGGACTGAAAGTACCACGGATATCTAGCAGAAAACTAAGATTCCGCCAACCTTCTCTGTTTGCCTATGACCAACAGCATCTCAGGGT
What happens when a helicase doesn't work?
Replication would be hard pressed to take place. Helicase is the enzyme that splits the double helix and unwinds this helix so that DNA polymerase can do it's job of running the leading and lagging strands of DNA in the replication process.
Why does DNA have to have hydrogen bonds?
Hydrogen bonds help hold the two strands of DNA together in a stable double helix structure. Without hydrogen bonds, the DNA molecule would not be able to maintain its shape and function properly as the genetic material of the cell.
What is the half of this DNA strand?
you have to give the DNA sequence formula for ex: TCGAACT the other half must be AGCTTGA
