0
What would the end of the double helix look like if the strands were parallel?
Wiki User
∙ 10y ago
they would have 3' and 5' at the same end
Wiki User
∙ 10y ago
Add your answer:
Earn +20 pts
In the double helix shape of DNA what series of nucleotides would match the nucleotide series g-a-c-t?
double helix
How many strands of nucleotides are in a DNA molecule?
There are two strands of DNA in a DNA double helix, each consisting of many nucleotide subunits. They are like building blocks that make up the DNA molecule, which would then be like a block tower. A 'strand of nucleotides' as you put it would basically be a DNA molecule (if they are deoxyribose nucleotides) or if they are ribose nucleotides, they would be a RNA molecule. DNA can come in double stranded helices (most of the time) or can be single stranded (as in some viruses).
What are the major differences between semi-conservative and conservative replication?
According to the conservative mode, of the two double helices formed one would be entirely of old material and the other entirely of new material. Thus the old parent double helix would be unchanged. According to the semi Conservative mode proposed by Watson and Crick, each strand of the two double helices formed would have one old and one new strand
How did Watson and Crick discover that the triple helix model of DNA was incorrect?
This model was based on 3 strands with unionized phosphate groups in the middle holding the molecule together. This didn't make sense because if the phosphate groups still had hydrogens, DNA would not be an acid... which it is.
What does it mean to say DNA polymerase reads a template strand to make the complementary strand?
During DNA replication, the enzyme DNA polymerase catalyses the formation of new strands of DNA, using the old strands as models. DNA has a double-helix structure, with two strands forming each helix. Each strand is made up of DNA nucleotides, with the genetic information encoded in the sequence of different nucleotides (different nucleotides are distinguished by molecules called 'bases' attached to them, so the sequence of nucleotides is known as the 'base sequence'). The base sequence of one strand is complementary to that of its' neighbour - the base A binds with T, and C with G, so if one strand had the sequence ATTACA, the base sequence of the complementary strand would be TAATGT. When DNA polymerase creates a new DNA strand, it does so by matching nucleotides to the base sequence of one of the strands - the template strand. New nucleotides are brought in, which match the template in a complementary fashion (ie. A-T, C-G), and join to become one new strand. This new strand is complementary to the template.
What would the ends of the double helix look like if the strands were parallel?
they would have 3' and 5' at the same end
What is the moleculer shape of dna?
DNA molecule is shaped like a spiral staircase and is composed of two parallel strands of linked subunits.
What happens If all of the hydrogen bonds in a DNA molecule were to break?
The double helix would be torn into two single strands.
How would you describe the shape of DNA?
The shape of DNA is normally described as a double-helix, which is two strands twirled loosely around each other. A common metaphor used for it is a spiraling staircase.
What happens when a helicase doesn't work?
Replication would be hard pressed to take place. Helicase is the enzyme that splits the double helix and unwinds this helix so that DNA polymerase can do it's job of running the leading and lagging strands of DNA in the replication process.
In the double helix shape of DNA what series of nucleotides would match the nucleotide series g-a-c-t?
double helix
DNA molecule antiparallel Why?
The DNA molecule is anti-parallel. This is because the two strands are the opposite of one another, such that if one strand has the base sequence ATC, the opposite strand would have the base sequence TAG.
What type of bonding holds the two strands of DNA together and why is this important?
hydrogen bonding between the two bases present on two strands of dna hold the two strands. If there was no hydrogen bonding then doublex helix structure of dna would not be possible
How would you describe the appearance of DNA molecule?
DNA stands for deoxiribonucliec acid and is shown in the form of a double helix. DNA particles themselves are two small for the naked eye to see but forms of DNA are things such as: hair strands, Nail clippings, fingerprints, skin cells, saliva, ect. basically anything that is part of your body.
How many strands of nucleotides are in a DNA molecule?
There are two strands of DNA in a DNA double helix, each consisting of many nucleotide subunits. They are like building blocks that make up the DNA molecule, which would then be like a block tower. A 'strand of nucleotides' as you put it would basically be a DNA molecule (if they are deoxyribose nucleotides) or if they are ribose nucleotides, they would be a RNA molecule. DNA can come in double stranded helices (most of the time) or can be single stranded (as in some viruses).
What does a DNA nucleotide look like?
TCCAAGAACCTACATGTTCGCGTGTTCAGCGTCCATTTCAGTATTTAGCATAAATTTGAAGAGCCGAATGGCAGTTTTGGGAGGGACACGTTGTTTTAAAAGAAGCCTTCACGAAATTGTGACCGGTCTGGACTGAAAGTACCACGGATATCTAGCAGAAAACTAAGATTCCGCCAACCTTCTCTGTTTGCCTATGACCAACAGCATCTCAGGGT
How would you describe the structure dna?
DNA looks like a ladder that has been twisted into a spiral. This shape is referred to as a helix shape.
