0
What else can I help you with?
What is the corresponding sequence to the base sequence TACCGCTT?
ATGGCGAA for DNA AUGGCGAA for RNA
What is the corresponding mRNA sequence to ATGCCCTAAGTG of an unraveled section of DNA?
The corresponding mRNA sequence of ATGCCCTAAGTG is UACGGGAUUCAC
A section of DNA has the base sequence GCTTAA the corresponding messanger RNA base sequence will be?
RNA is copied just like DNA, except thymine (T) is replaced by uracil (U), so the corresponding base sequence for GCTTAA would be CGAAUU
What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg?
I though the question is asking the complimentary strand of the sequence. It would be TCCGGTAATCGGGATAAGCCCATATTTACC. Adenine pairs with thymine and guanine pair up cytosine by hydrogen bonds.
DNA sequence acgtt will give what mRNA base sequence?
The mRNA base sequence corresponding to the DNA sequence acgtt is ugcaa. The mRNA sequence is complementary to the DNA sequence, with thymine (T) in DNA being replaced by uracil (U) in mRNA.
How do you write the amino acid sequence for u-g-a-u-g-g-g-u-a-c-g-g-u-c?
The given sequence "U-G-A-U-G-G-G-U-A-C-G-G-U-C" represents the RNA sequence, not the amino acid sequence. To determine the corresponding amino acid sequence, you would need to perform translation by converting the RNA sequence into its complementary DNA sequence, then group the nucleotides into codons, and use the genetic code to find the corresponding amino acids.
What is a corresponding term?
A corresponding term refers to an element or value that is related to another within a particular context, such as in sequences, sets, or functions. For example, in two parallel sequences, the corresponding term of one sequence is directly aligned with a term in the other sequence based on their positions. This concept is often used in mathematics and logic to establish relationships between different entities.
What is the puorpose of anticodons?
a codon is a sequence of 3 nucleotides, the tRNA anticodons is the comlementary pairs with its corresponding mRNA codon.
In DNA what process does the corresponding sequence a-c-t-t-g to t-g-a-a-c occur?
Transcription.
What is the base sequence at the 3' end of all tRNAs?
The base sequence at the 3' end of all tRNAs is CCA. This sequence is added post-transcriptionally during tRNA processing and is important for tRNA charging with the corresponding amino acid.
If the sequence of bases in one DNA strand is TAG then the sequence of bases in the other strand will be?
The corresponding mRNA strand would be AUCG.
Which base sequence in DNA is complementary to the base sequence atgt?
ATAGCC is complementary to the base sequence TATCGG.
