0
What else can I help you with?
A section of DNA has the base sequence GCTTAA the corresponding messanger RNA base sequence will be?
RNA is copied just like DNA, except thymine (T) is replaced by uracil (U), so the corresponding base sequence for GCTTAA would be CGAAUU
What is the corresponding mRNA sequence to ATGCCCTAAGTG of an unraveled section of DNA?
The corresponding mRNA sequence of ATGCCCTAAGTG is UACGGGAUUCAC
DNA sequence acgtt will give what mRNA base sequence?
The mRNA base sequence corresponding to the DNA sequence acgtt is ugcaa. The mRNA sequence is complementary to the DNA sequence, with thymine (T) in DNA being replaced by uracil (U) in mRNA.
What is the corresponding sequence of tcacgtatgc?
The corresponding sequence of the DNA strand "tcacgtatgc" can be determined by finding its complementary base pairs. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, the complementary sequence is "agtgcatacg."
Which base sequence in DNA is complementary to the base sequence atgt?
ATAGCC is complementary to the base sequence TATCGG.
What is the base sequence at the 3' end of all tRNAs?
The base sequence at the 3' end of all tRNAs is CCA. This sequence is added post-transcriptionally during tRNA processing and is important for tRNA charging with the corresponding amino acid.
Base Sequence CGT ACG GCT AC WHAT WOULD BE the base sequence formed by transcription?
During transcription, the DNA sequence is converted into a complementary RNA sequence. For the given DNA base sequence CGT ACG GCT AC, the corresponding RNA sequence would be GCA UGC CGA UG. This involves replacing thymine (T) with uracil (U) in RNA.
What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg?
I though the question is asking the complimentary strand of the sequence. It would be TCCGGTAATCGGGATAAGCCCATATTTACC. Adenine pairs with thymine and guanine pair up cytosine by hydrogen bonds.
If one strand of the DNA has a base sequence of acggttaactaagc?
Then the corresponding side of the DNA will be tgccaattgattcg. When this side is transcribed, the resulting RNA will look like ugccaauugauucg.
What is the relationship between a base pair and the corresponding amino acid in the process of protein synthesis?
During protein synthesis, a base pair in DNA codes for a specific amino acid. This relationship is crucial because the sequence of base pairs determines the sequence of amino acids in a protein, ultimately influencing its structure and function.
Which genetic change is best described by the following statement A random change in the base sequence of DNA results in an alteration of a polypeptide?
A point mutation is best described by this statement. Point mutations occur when there is a change in a single nucleotide base in the DNA sequence, which can lead to changes in the corresponding amino acid sequence of a polypeptide during protein synthesis.
If the base sequence of the DNA is gtcaggatc what would be the corresponding base sequence of the messenger rna?
Wrong. UAC is the complimentary base sequence on the mRNA strand. RNA does not use the T nucleotide don u think if it should be written like CAU coz rna polymerase reads 3 to 5 and gives 5 to 3
