0
What else can I help you with?
What would be the mrna base sequence formed during transcription using the DNA sequence below?
Transcription produces a strand of messenger RNA that is complementary to the DNA that it transcribed. For example, the DNA sequence AGTCGA would be transcribed by messenger RNA as UCAGCU.
What sequence of mRNA would go with the DNA sequence of act?
If the DNA sequence is ACT, the complimentary mRNA sequence would be UGA
An original DNA strand has the following base sequence ACGTAAGCT What base sequence would be produced through transcription?
During transcription, the DNA sequence ACGTAAGCT is translated into a complementary RNA sequence. The base pairing rules dictate that adenine (A) pairs with uracil (U) in RNA instead of thymine (T) found in DNA. Thus, the RNA sequence produced would be UGCAUUCGAA.
The order of bases on a segment of DNA is represented by C-A-C-T-G-A. What would be the end result of transcription for this sequence?
During transcription, the DNA sequence C-A-C-T-G-A would be transcribed into a complementary RNA sequence. The corresponding RNA bases would be G-U-G-A-C-U, where adenine (A) pairs with uracil (U) in RNA instead of thymine (T). Therefore, the end result of transcription for this DNA sequence would be the RNA sequence G-U-G-A-C-U.
What is the sequence of the mRNA made from the gene TTACAGGTCCCA?
The sequence of the mRNA transcribed from the DNA gene TTACAGGTCCCA would be complementary to the template strand of the DNA. Since mRNA is synthesized using uracil (U) instead of thymine (T), the corresponding mRNA sequence would be AAUGUCCAGGGU. This sequence reflects the direct transcription of the DNA template, replacing each thymine with uracil.
What would be the mrna base sequence formed during transcription using the DNA sequence below?
Transcription produces a strand of messenger RNA that is complementary to the DNA that it transcribed. For example, the DNA sequence AGTCGA would be transcribed by messenger RNA as UCAGCU.
What amino acid would be produced if transcription took place from the DNA sequence CAT?
Transcription of the DNA sequence CAT would produce the messenger RNA sequence CAU. This mRNA sequence would then be translated by ribosomes to produce the amino acid histidine.
What sequence of mRNA would go with the DNA sequence of act?
If the DNA sequence is ACT, the complimentary mRNA sequence would be UGA
An original DNA strand has the following base sequence ACGTAAGCT What base sequence would be produced through transcription?
During transcription, the DNA sequence ACGTAAGCT is translated into a complementary RNA sequence. The base pairing rules dictate that adenine (A) pairs with uracil (U) in RNA instead of thymine (T) found in DNA. Thus, the RNA sequence produced would be UGCAUUCGAA.
The order of bases on a segment of DNA is represented by C-A-C-T-G-A. What would be the end result of transcription for this sequence?
During transcription, the DNA sequence C-A-C-T-G-A would be transcribed into a complementary RNA sequence. The corresponding RNA bases would be G-U-G-A-C-U, where adenine (A) pairs with uracil (U) in RNA instead of thymine (T). Therefore, the end result of transcription for this DNA sequence would be the RNA sequence G-U-G-A-C-U.
If DNA has the sequence AAA then a segment of mRNA would be what?
If DNA has the sequence AAA, the corresponding mRNA segment would have the sequence UUU due to complementary base pairing during transcription. This mRNA sequence would then undergo translation in order to produce a protein based on the genetic information contained in the DNA.
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."
What is the sequence of the mRNA made from the gene TTACAGGTCCCA?
The sequence of the mRNA transcribed from the DNA gene TTACAGGTCCCA would be complementary to the template strand of the DNA. Since mRNA is synthesized using uracil (U) instead of thymine (T), the corresponding mRNA sequence would be AAUGUCCAGGGU. This sequence reflects the direct transcription of the DNA template, replacing each thymine with uracil.
What base sequence would be produced through transcription ACGTAAGCT?
gaugcgauccguaaucugaccau
Which of these is the correct mRNA that would be produced from this segment of DNA tactaggctaat?
The correct mRNA sequence that would be produced from the DNA sequence "tactaggctaat" is "auguccgcuuau". This is because in mRNA, thymine (T) is replaced by uracil (U) and the complementary mRNA sequence is produced from the DNA template during transcription.
What would the HIV viral sequence of AUCUU be converted to and by what enzyme?
The HIV virus is an RNA virus, so you know the sequence AUCUU is the RNA sequence. (You also know it is RNA because it contains uracil.) HIV is a retrovirus, so its RNA will be transcribed to DNA by the enzyme reverse transcriptase and then inserted into the host's genome. The RNA sequence of AUCUU would be transcribed to TAGTT.
What is the nucleotides sequence of the mRNA strand you build?
The nucleotide sequence of the mRNA strand is determined by the DNA template strand during transcription. If the DNA template sequence is, for example, 3'-ATCGTAGC-5', the corresponding mRNA sequence synthesized would be 5'-UAGCAUCG-3'. The mRNA sequence consists of complementary RNA nucleotides, where adenine (A) pairs with uracil (U) and cytosine (C) pairs with guanine (G).
