0
If DNA has the sequence AAA then a segment of mRNA would be what?
Wiki User
∙ 9y ago
it has twenty-four dick cells
Wiki User
∙ 9y ago
Anonymous
Add your answer:
Earn +20 pts
What is the amino acid sequence that is coded for the mRNA sequence AUG-ACG-AAA-AGA-AGG-GGA-GCC-GCU-UCC-UAA?
The amino acid sequence is: UUU-UCU-UCC-CCU-CGG-CGA-AGG-AUU.
What is the significance of a polytail consisting of AAA at the end of a mRNA sequence?
The poly adenine tail is used to provide a fuse. This is because RNase enzymes cleave off a section of the nucleotides at the end of the mRNA strand. The destruction of the mRNA is to prevent it persisting within the cell after being used, the length of the tail shows how many times it will be used before being degraded.
Consider a strand of DNA with this sequence AAA tga caa cta cca tct tga gca aca aga what is the corresponding sequence of the other side of the DNA helix how would you get the answer?
tttactgttgatggtagaactcgttgttct
What is the matching anticodon for UUU?
My guess would be AAA
What will the 2nd condon in mrna be acc tta ggc cct tca ccc agt ttt AAA?
aau uut tta aat which is it
What is the sequence of bases of the mrna for tacaaatttgcaaccact?
TAC AAA TTT GCA ACC ACT (DNA) AUG UUU AAA CGU UGG UGA (mRNA)
What is the amino acid sequence that is coded for the mRNA sequence AUG-ACG-AAA-AGA-AGG-GGA-GCC-GCU-UCC-UAA?
The amino acid sequence is: UUU-UCU-UCC-CCU-CGG-CGA-AGG-AUU.
What is the sequence of the mRna produced from the strand of DNA a t a t g c g c t a a a?
AUA - Ile, AGC - Ser, GCU - Ala, and AAA is Lysine.
What is the significance of a polytail consisting of AAA at the end of a mRNA sequence?
The poly adenine tail is used to provide a fuse. This is because RNase enzymes cleave off a section of the nucleotides at the end of the mRNA strand. The destruction of the mRNA is to prevent it persisting within the cell after being used, the length of the tail shows how many times it will be used before being degraded.
Consider a strand of DNA with this sequence AAA tga caa cta cca tct tga gca aca aga what is the corresponding sequence of the other side of the DNA helix how would you get the answer?
tttactgttgatggtagaactcgttgttct
Codons found in messenger RNA?
Anticodons are sequences of three base pairs on a transfer RNA that correspond to (and subsequently pair up with) codons on messenger RNAs. These complementary pairs come together by forming hydrogen bonds. For example, a tRNA with the anticodon UUU may correspond to the codon AAA on the mRNA.
What amino acid would be made form the mRNA code for a a a?
AGT codes for the amino acid serine and CTT codes for the amino acid leucine.
What is the matching anticodon for UUU?
My guess would be AAA
What will the 2nd condon in mrna be acc tta ggc cct tca ccc agt ttt AAA?
aau uut tta aat which is it
Why does the same enzyme cut DNA at different places?
Because restriction enzymes recognised site normally are more than one.For example, if an enzyme recognise three Base pair such us AAA and the copy segment of DNA has 5 AAA segment than the enzyme will cut the DNA into 5 picies.
What amino acid does rna sequence AAA specify?
No amino acid is coded for. It is a stop codon that instructs to stop the process of translation.
What is the next answer Aaa aAA aAa AaA aaA?
AAa
