0
What else can I help you with?
A section of DNA has the base sequence GCTTAA the corresponding messanger RNA base sequence will be?
RNA is copied just like DNA, except thymine (T) is replaced by uracil (U), so the corresponding base sequence for GCTTAA would be CGAAUU
What would be the mrna base sequence formed during transcription using the DNA sequence below?
Transcription produces a strand of messenger RNA that is complementary to the DNA that it transcribed. For example, the DNA sequence AGTCGA would be transcribed by messenger RNA as UCAGCU.
What is the correct match for the following sequence if you were converting to RNA the sequence is CGTTAA?
To convert the DNA sequence CGTTAA to RNA, you would replace thymine (T) with uracil (U). Therefore, the corresponding RNA sequence would be CGUUAA.
What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg?
I though the question is asking the complimentary strand of the sequence. It would be TCCGGTAATCGGGATAAGCCCATATTTACC. Adenine pairs with thymine and guanine pair up cytosine by hydrogen bonds.
What would be the resulting sequence of amino acids in this growing protein chain based on the sequence of bases in the illustrated messenger RNA?
To determine the resulting sequence of amino acids in a growing protein chain from the sequence of bases in a messenger RNA (mRNA), you first need to translate the mRNA codons into their corresponding amino acids using the genetic code. Each codon, consisting of three nucleotides, specifies a particular amino acid. By reading the mRNA sequence from the start codon (AUG) and converting each codon into its respective amino acid, you can construct the protein chain. If you provide the specific mRNA sequence, I can help you identify the resulting amino acid sequence.
A section of DNA has the base sequence GCTTAA the corresponding messanger RNA base sequence will be?
RNA is copied just like DNA, except thymine (T) is replaced by uracil (U), so the corresponding base sequence for GCTTAA would be CGAAUU
What would be the mrna base sequence formed during transcription using the DNA sequence below?
Transcription produces a strand of messenger RNA that is complementary to the DNA that it transcribed. For example, the DNA sequence AGTCGA would be transcribed by messenger RNA as UCAGCU.
What is the correct match for the following sequence if you were converting to RNA the sequence is CGTTAA?
To convert the DNA sequence CGTTAA to RNA, you would replace thymine (T) with uracil (U). Therefore, the corresponding RNA sequence would be CGUUAA.
What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg?
I though the question is asking the complimentary strand of the sequence. It would be TCCGGTAATCGGGATAAGCCCATATTTACC. Adenine pairs with thymine and guanine pair up cytosine by hydrogen bonds.
What amino acid would be produced if transcription took place from the DNA sequence CAT?
Transcription of the DNA sequence CAT would produce the messenger RNA sequence CAU. This mRNA sequence would then be translated by ribosomes to produce the amino acid histidine.
What would be the resulting sequence of amino acids in this growing protein chain based on the sequence of bases in the illustrated messenger RNA?
To determine the resulting sequence of amino acids in a growing protein chain from the sequence of bases in a messenger RNA (mRNA), you first need to translate the mRNA codons into their corresponding amino acids using the genetic code. Each codon, consisting of three nucleotides, specifies a particular amino acid. By reading the mRNA sequence from the start codon (AUG) and converting each codon into its respective amino acid, you can construct the protein chain. If you provide the specific mRNA sequence, I can help you identify the resulting amino acid sequence.
If DNA has the sequence AAA then a segment of mRNA would be what?
If DNA has the sequence AAA, the corresponding mRNA segment would have the sequence UUU due to complementary base pairing during transcription. This mRNA sequence would then undergo translation in order to produce a protein based on the genetic information contained in the DNA.
Base Sequence CGT ACG GCT AC WHAT WOULD BE the base sequence formed by transcription?
During transcription, the DNA sequence is converted into a complementary RNA sequence. For the given DNA base sequence CGT ACG GCT AC, the corresponding RNA sequence would be GCA UGC CGA UG. This involves replacing thymine (T) with uracil (U) in RNA.
If the sequence of bases in one DNA strand is TAG then the sequence of bases in the other strand will be?
The corresponding mRNA strand would be AUCG.
How do you write the amino acid sequence for u-g-a-u-g-g-g-u-a-c-g-g-u-c?
The given sequence "U-G-A-U-G-G-G-U-A-C-G-G-U-C" represents the RNA sequence, not the amino acid sequence. To determine the corresponding amino acid sequence, you would need to perform translation by converting the RNA sequence into its complementary DNA sequence, then group the nucleotides into codons, and use the genetic code to find the corresponding amino acids.
How do you translate this to to messenger RNA from DNA ccg atc gac cga?
To transcribe DNA to messenger RNA, you need to replace each DNA base with its RNA complement: G in DNA is transcribed to C in mRNA, C to G, A to U (uracil), and T to A. Therefore, the DNA sequence ccg atc gac cga would be transcribed to GGC UAG CUG GCU in mRNA.
What is the sequence of the mRNA made from the gene TTACAGGTCCCA?
The sequence of the mRNA transcribed from the DNA gene TTACAGGTCCCA would be complementary to the template strand of the DNA. Since mRNA is synthesized using uracil (U) instead of thymine (T), the corresponding mRNA sequence would be AAUGUCCAGGGU. This sequence reflects the direct transcription of the DNA template, replacing each thymine with uracil.
