0
What else can I help you with?
What strand of DNA is used to make a complementary copy or to make a complementary mRNA molecule-?
The template strand of DNA is used to make a complementary copy during DNA replication, while the antisense (non-coding) strand is used as a template for complementary mRNA synthesis during transcription.
What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?
During transcription, the DNA template is used to create a complementary strand of mRNA (messenger RNA). An A on the DNA template is complementary to a U on the mRNA, T to A and C to G. Therefore the complementary mRNA of TAC-GCG-CAT-TGT-CGT-CTA-GGT-TTC-GAT-ATA-TTA-GCT-ACG is: UTG-CGC-GUA-ACA-GCA-GAU-CCA-AAG-CUA-UAU-AAU-CGA-UGC
Why both strands of DNA are not copied during transcription?
During transcription, only one DNA strand is used as a template to synthesize an mRNA molecule. This strand is called the template or antisense strand. The other DNA strand, known as the coding or sense strand, is not used because it has the same sequence as the mRNA molecule being produced, except with thymine instead of uracil. Transcribing both strands would be redundant and energetically wasteful.
What are the differences between the template and coding strands in DNA replication?
During DNA replication, the template strand is used as a guide to create a complementary copy, while the coding strand is not directly involved in the copying process. The template strand determines the sequence of nucleotides in the new DNA strand, while the coding strand has the same sequence as the RNA transcript that will be produced from the new DNA strand.
Is transcription the manufacture of a strand of RNA complementary to a strand of DNA?
Yes, that's correct. Transcription is the process by which the genetic information in a segment of DNA is used to create a complementary RNA strand. This RNA molecule can then be used to direct the synthesis of proteins in a cell.
Is this strand of DNA was used what would be the complementary DNA produced?
To determine the complementary DNA strand produced from a given DNA strand, you pair the nucleotides according to base pairing rules: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). For example, if the DNA strand is 5'-ATCG-3', the complementary strand would be 3'-TAGC-5'. Thus, the complementary DNA sequence is synthesized in the opposite direction.
If the strand of DNA were used what would be the complementary DNA produced?
To determine the complementary DNA strand, you would pair each base of the original DNA strand with its corresponding complementary base: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). For example, if the original strand is ATCG, the complementary strand would be TAGC. This base-pairing rule ensures that the two strands of DNA are complementary, allowing for proper replication and function.
If this strand of DNA were used GTA CA what would be the complementary DNA produced?
CAT GT. -APEX Learning
In this strand of DNA was used that would be the complementary DNA Produced?
To determine the complementary DNA strand produced from a given DNA sequence, you need to match each nucleotide with its complementary base: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). For example, if the original DNA strand is 5'-ATCG-3', the complementary strand would be 3'-TAGC-5'. The directionality of the strands is also important, so ensure to maintain the 5' to 3' orientation when writing the complementary sequence.
If this CGA CT strand of DNA was used what would be the complementry DNA produced?
The complementary DNA strand to the CGA CT strand would be GCT AG. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base in the original strand is matched with its complementary base to form the new strand.
F this strand of DNA was used what would be the complementary DNA produced CGA CT?
To find the complementary DNA strand for the given sequence "CGA CT," you need to pair each base with its complementary base: Cytosine (C) pairs with Guanine (G), Guanine (G) pairs with Cytosine (C), and Adenine (A) pairs with Thymine (T). Thus, the complementary DNA produced would be "GCT GA."
What strand of DNA is used to make a complementary copy or to make a complementary mRNA molecule-?
The template strand of DNA is used to make a complementary copy during DNA replication, while the antisense (non-coding) strand is used as a template for complementary mRNA synthesis during transcription.
If this strand of DNA were used. what would be the complementary DNA produced?
To determine the complementary DNA strand, you would pair each nucleotide with its corresponding base: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). For example, if the original strand of DNA is 5'-ATCGTA-3', the complementary strand would be 3'-TAGCAT-5'. This complementary pairing ensures that the two strands are held together by hydrogen bonds, maintaining the double helix structure of DNA.
What strand of DNA is use to make a complementary copy or to make a complementary mRNA molecule?
The template strand is used to make a complementary copy. This is a type of DNA strand.
If this strand of DNA was used what would be the complementary DNA produced CGA CT A. TAG TC B. CGA CT C. GCG GA D. GCT GA?
The complementary DNA strand is formed by pairing adenine (A) with thymine (T) and cytosine (C) with guanine (G). Given the DNA strand CGA CT A, the complementary sequence would be GCT GA T. Among the options provided, the closest match is D. GCT GA.
What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?
During transcription, the DNA template is used to create a complementary strand of mRNA (messenger RNA). An A on the DNA template is complementary to a U on the mRNA, T to A and C to G. Therefore the complementary mRNA of TAC-GCG-CAT-TGT-CGT-CTA-GGT-TTC-GAT-ATA-TTA-GCT-ACG is: UTG-CGC-GUA-ACA-GCA-GAU-CCA-AAG-CUA-UAU-AAU-CGA-UGC
If this strand of DNA was used what would be the complementary DNA produced tac gg?
AGTCG (I'm assuming your strand was written in the normal 5' to 3' order, and I wrote mine in that order as well, which means the last residue in my strand pairs with the first residue in your strand, and vice versa).
