answersLogoWhite

0

AGTCG (I'm assuming your strand was written in the normal 5' to 3' order, and I wrote mine in that order as well, which means the last residue in my strand pairs with the first residue in your strand, and vice versa).

User Avatar

Wiki User

8y ago

What else can I help you with?

Continue Learning about Biology

What strand of DNA is used to make a complementary copy or to make a complementary mRNA molecule-?

The template strand of DNA is used to make a complementary copy during DNA replication, while the antisense (non-coding) strand is used as a template for complementary mRNA synthesis during transcription.


What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?

During transcription, the DNA template is used to create a complementary strand of mRNA (messenger RNA). An A on the DNA template is complementary to a U on the mRNA, T to A and C to G. Therefore the complementary mRNA of TAC-GCG-CAT-TGT-CGT-CTA-GGT-TTC-GAT-ATA-TTA-GCT-ACG is: UTG-CGC-GUA-ACA-GCA-GAU-CCA-AAG-CUA-UAU-AAU-CGA-UGC


What are the differences between the template and coding strands in DNA replication?

During DNA replication, the template strand is used as a guide to create a complementary copy, while the coding strand is not directly involved in the copying process. The template strand determines the sequence of nucleotides in the new DNA strand, while the coding strand has the same sequence as the RNA transcript that will be produced from the new DNA strand.


Why both strands of DNA are not copied during transcription?

During transcription, only one DNA strand is used as a template to synthesize an mRNA molecule. This strand is called the template or antisense strand. The other DNA strand, known as the coding or sense strand, is not used because it has the same sequence as the mRNA molecule being produced, except with thymine instead of uracil. Transcribing both strands would be redundant and energetically wasteful.


Is transcription the manufacture of a strand of RNA complementary to a strand of DNA?

Yes, that's correct. Transcription is the process by which the genetic information in a segment of DNA is used to create a complementary RNA strand. This RNA molecule can then be used to direct the synthesis of proteins in a cell.

Related Questions

If this strand of DNA were used GTA CA what would be the complementary DNA produced?

CAT GT. -APEX Learning


What strand of DNA is used to make a complementary copy or to make a complementary mRNA molecule-?

The template strand of DNA is used to make a complementary copy during DNA replication, while the antisense (non-coding) strand is used as a template for complementary mRNA synthesis during transcription.


What strand of DNA is use to make a complementary copy or to make a complementary mRNA molecule?

The template strand is used to make a complementary copy. This is a type of DNA strand.


What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?

During transcription, the DNA template is used to create a complementary strand of mRNA (messenger RNA). An A on the DNA template is complementary to a U on the mRNA, T to A and C to G. Therefore the complementary mRNA of TAC-GCG-CAT-TGT-CGT-CTA-GGT-TTC-GAT-ATA-TTA-GCT-ACG is: UTG-CGC-GUA-ACA-GCA-GAU-CCA-AAG-CUA-UAU-AAU-CGA-UGC


If this strand of DNA was used what would be the complementary DNA produced tac gg?

AGTCG (I'm assuming your strand was written in the normal 5' to 3' order, and I wrote mine in that order as well, which means the last residue in my strand pairs with the first residue in your strand, and vice versa).


If cga ct were used what would be the complimentary DNA produced?

If cga ct were used as a template strand for complementary DNA synthesis, the complementary DNA produced would be gct ga. This is because each nucleotide pairs with its complementary base: cytosine (c) pairs with guanine (g), guanine (g) pairs with cytosine (c), adenine (a) pairs with thymine (t), and thymine (t) pairs with adenine (a). Therefore, the complementary sequence would read from 5' to 3' as gct ga.


What is the complementary strand of DNA?

The complementary strand of DNA is a strand that matches the sequence of the original DNA strand through base pairing rules. Adenine pairs with thymine (A-T) and cytosine pairs with guanine (C-G). This results in two DNA strands with complementary sequences that can be used for replication and transcription.


What is used to make a new complementary strand of DNA?

The process of DNA replication.


What are the differences between the template and coding strands in DNA replication?

During DNA replication, the template strand is used as a guide to create a complementary copy, while the coding strand is not directly involved in the copying process. The template strand determines the sequence of nucleotides in the new DNA strand, while the coding strand has the same sequence as the RNA transcript that will be produced from the new DNA strand.


Why both strands of DNA are not copied during transcription?

During transcription, only one DNA strand is used as a template to synthesize an mRNA molecule. This strand is called the template or antisense strand. The other DNA strand, known as the coding or sense strand, is not used because it has the same sequence as the mRNA molecule being produced, except with thymine instead of uracil. Transcribing both strands would be redundant and energetically wasteful.


What does DNA do after it is copied?

It joins up with its complementary strand. I may then be used to make RNA.


If this stand of DNA was used, what would be the complementary DNA produced CGA CT?

GCT GA :)