Deoxyribonucleic acid
The term for the 5' DNA strand is the leading strand.
The complementary strand of DNA to the template strand TACGGCTA would be ATGCCGAT.
The term for the 3' to 5' strand of DNA is the "antisense strand."
The DNA strand that is copied to make mRNA is the template strand of the gene. This strand serves as a template for the RNA polymerase enzyme to synthesize a complementary mRNA strand during the process of transcription.
replicated DNA is made of one old strand and one new strand.
replicated DNA is made of one old strand and one new strand.
The template strand, if reffering to DNA, is the strand of the DNA that is copied to make more DNA.
Simply means one strand is conserved, as the original template and the other strand in the double stranded DNA is modified.
The term for the 5' DNA strand is the leading strand.
The complementary strand of DNA to the template strand TACGGCTA would be ATGCCGAT.
The DNA strand that acts as a pattern for the newly synthesized DNA is called the template strand. It serves as a guide during DNA replication, where complementary nucleotides are added to create a new DNA strand.
its like a cell that runs throw you
No because it changes letters so the primer will not be the correct match. They have to be different.For example, the original DNA strand is AATGCGTACTAGCTAGTCTTAGTC and the primer is TTACGC. There is no other match to the DNA strand so a new one will have to be used.
It is a copy of the Dna original strand.
The complementary DNA strand to ACTGGCTAC is TGACCGATG.
The term for the 3' to 5' strand of DNA is the "antisense strand."
GGATCGA is comlementary to the DNA strand CCTAGCT.