answersLogoWhite

0

Deoxyribonucleic acid

User Avatar

Wiki User

15y ago

What else can I help you with?

Related Questions

What does semi conservative mean regard to DNA replication?

replicated DNA is made of one old strand and one new strand.


What is the strand?

The template strand, if reffering to DNA, is the strand of the DNA that is copied to make more DNA.


What does semi conservation mean in DNA?

Simply means one strand is conserved, as the original template and the other strand in the double stranded DNA is modified.


What is the term for the 5' DNA strand?

The term for the 5' DNA strand is the leading strand.


What strand of DNA would be prod from the template strand of DNA shown below?

The complementary strand of DNA to the template strand TACGGCTA would be ATGCCGAT.


What is the term for the DNA strand that acts as a pattern to the newly synthesized DNA?

The DNA strand that acts as a pattern for the newly synthesized DNA is called the template strand. It serves as a guide during DNA replication, where complementary nucleotides are added to create a new DNA strand.


What is mean by complementary strand of DNA?

its like a cell that runs throw you


Could DNA be amplified with only one primer?

No because it changes letters so the primer will not be the correct match. They have to be different.For example, the original DNA strand is AATGCGTACTAGCTAGTCTTAGTC and the primer is TTACGC. There is no other match to the DNA strand so a new one will have to be used.


What is the role of the DNA new strand?

It is a copy of the Dna original strand.


Given the following strand of dna what is the complementary strand actggctac?

The complementary DNA strand to ACTGGCTAC is TGACCGATG.


What is the term for the 3' to 5' strand of DNA?

The term for the 3' to 5' strand of DNA is the "antisense strand."


What is the complementary DNA strand of CCTAGCT?

GGATCGA is comlementary to the DNA strand CCTAGCT.