Well I Can Say That It Is Just Basically A Type Of Gene You Receive From Your Parents
The unique sequence of DNA base pairs that can be used to identify a person at the molecular level is called a DNA fingerprint.
The presence of the nucleotides adenine (A) and thymine (T) in a DNA sequence signifies a complementary base pairing, where A always pairs with T.
The individuality of an organism is determined by its genetic makeup, environmental influences, and unique development process. These factors interact to shape the physical and behavioral characteristics that distinguish the organism from others.
The sequence shown is "ACAGTGC".
The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."
The unique sequence of DNA base pairs that can be used to identify a person at the molecular level is called a DNA fingerprint.
The unique base sequence if the individuals dnA
The presence of the nucleotides adenine (A) and thymine (T) in a DNA sequence signifies a complementary base pairing, where A always pairs with T.
The individuality of an organism is determined by its genetic makeup, environmental influences, and unique development process. These factors interact to shape the physical and behavioral characteristics that distinguish the organism from others.
TACA
The base sequence of mRnas is 'determined by the base sequence of nucleotides in Dna.' The base sequence is transformed into information via the triplet codons of The Genetic Code.
ATAGCC is complementary to the base sequence TATCGG.
boo
You can predict the base sequence of one strand of DNA if you know the sequence of the other strand because DNA strands are complementary. Adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). This complementary base pairing allows the sequence of one strand to dictate the sequence of the other, enabling accurate predictions of the base sequence.
The mRNA base sequence corresponding to the DNA sequence acgtt is ugcaa. The mRNA sequence is complementary to the DNA sequence, with thymine (T) in DNA being replaced by uracil (U) in mRNA.
The sequence shown is "ACAGTGC".
TACA