0
What else can I help you with?
What is the unique sequence of DNA base pairs that can be used to identify a person at the molecular level?
The unique sequence of DNA base pairs that can be used to identify a person at the molecular level is called a DNA fingerprint.
What does the presence of the nucleotides adenine (A) and thymine (T) in a DNA sequence signify?
The presence of the nucleotides adenine (A) and thymine (T) in a DNA sequence signifies a complementary base pairing, where A always pairs with T.
The individuality of an organism is determined by the organisms?
The individuality of an organism is determined by its genetic makeup, environmental influences, and unique development process. These factors interact to shape the physical and behavioral characteristics that distinguish the organism from others.
A base sequence is shown below. ACAGTGC?
The sequence shown is "ACAGTGC".
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."
What is the unique sequence of DNA base pairs that can be used to identify a person at the molecular level?
The unique sequence of DNA base pairs that can be used to identify a person at the molecular level is called a DNA fingerprint.
What accounts for the differences between organisms?
The unique base sequence if the individuals dnA
What does the presence of the nucleotides adenine (A) and thymine (T) in a DNA sequence signify?
The presence of the nucleotides adenine (A) and thymine (T) in a DNA sequence signifies a complementary base pairing, where A always pairs with T.
The individuality of an organism is determined by the organisms?
The individuality of an organism is determined by its genetic makeup, environmental influences, and unique development process. These factors interact to shape the physical and behavioral characteristics that distinguish the organism from others.
What sequence of DNA base bonds with DNA base sequence ATGT?
TACA
The order of bases in a molecule of mRNA is determined by the sequence?
The base sequence of mRnas is 'determined by the base sequence of nucleotides in Dna.' The base sequence is transformed into information via the triplet codons of The Genetic Code.
Which base sequence in DNA is complementary to the base sequence atgt?
ATAGCC is complementary to the base sequence TATCGG.
What is base sequence?
boo
Why can you predict the base sequence of one strand in amloecule of DNA if you know the sequence of the other stand?
You can predict the base sequence of one strand of DNA if you know the sequence of the other strand because DNA strands are complementary. Adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). This complementary base pairing allows the sequence of one strand to dictate the sequence of the other, enabling accurate predictions of the base sequence.
DNA sequence acgtt will give what mRNA base sequence?
The mRNA base sequence corresponding to the DNA sequence acgtt is ugcaa. The mRNA sequence is complementary to the DNA sequence, with thymine (T) in DNA being replaced by uracil (U) in mRNA.
What sequence of DNA bases with the DNA base sequence atgt?
TACA
A base sequence is shown below. ACAGTGC?
The sequence shown is "ACAGTGC".
