The sequence shown is "ACAGTGC".
The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."
CCGTAGGCC is a sequence of DNA base pairs. It represents the complementary DNA strand to the original sequence GGCTACGG, where each base pairs with its complementary base (A with T and C with G).
A TG CAGATTCTCTAAG
The complementary DNA base sequence that would bond with ATGT is TACA. In DNA, adenine pairs with thymine, and guanine pairs with cytosine. This follows the base pairing rules of DNA.
sequence of nucleotides. This sequence contains the genetic information that determines the characteristics of an organism, including its physical traits and how it functions. Differences in the DNA sequence among species account for the vast diversity of life on Earth.
To determine the complementary DNA base sequence for a given strand, you need to know the base pairing rules: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). If you provide the specific sequence of the partial DNA strand, I can help you identify the complementary bases that would pair with it.
TACA
To provide the complementary strand of DNA, I would need to see the specific sequence of the given DNA strand. DNA strands are complementary based on base pairing rules: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). If you provide the sequence, I can generate the corresponding complementary strand for you.
Transcription produces a strand of messenger RNA that is complementary to the DNA that it transcribed. For example, the DNA sequence AGTCGA would be transcribed by messenger RNA as UCAGCU.
The base sequence of mRnas is 'determined by the base sequence of nucleotides in Dna.' The base sequence is transformed into information via the triplet codons of The Genetic Code.
ATAGCC is complementary to the base sequence TATCGG.
boo
You can predict the base sequence of one strand of DNA if you know the sequence of the other strand because DNA strands are complementary. Adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). This complementary base pairing allows the sequence of one strand to dictate the sequence of the other, enabling accurate predictions of the base sequence.
The complementary DNA strand produced from the given strand "cgt" would follow the base pairing rules of adenine (A) with thymine (T) and cytosine (C) with guanine (G). Therefore, for the sequence "cgt," the complementary strand would be "gca."
The mRNA base sequence corresponding to the DNA sequence acgtt is ugcaa. The mRNA sequence is complementary to the DNA sequence, with thymine (T) in DNA being replaced by uracil (U) in mRNA.
TACA
The complementary DNA strand produced from the given DNA sequence "CGT ATA" would be "GCA TAT." In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base in the original strand is replaced by its complementary base in the new strand.