answersLogoWhite

0

CAT GT.

-APEX Learning

User Avatar

Nathan Fatiga

Lvl 7
4y ago

What else can I help you with?

Continue Learning about Biology

A gene has the base sequence that starts with TCG GAC CAT CGA a) What would be the complementary DNA strand formed from this DNA ing?

The complementary DNA strand would be AGC CTG GTA GCT. In DNA, adenine pairs with thymine and cytosine pairs with guanine. Therefore, the complementary strand is formed by replacing each base with its complementary base.


What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?

During transcription, the DNA template is used to create a complementary strand of mRNA (messenger RNA). An A on the DNA template is complementary to a U on the mRNA, T to A and C to G. Therefore the complementary mRNA of TAC-GCG-CAT-TGT-CGT-CTA-GGT-TTC-GAT-ATA-TTA-GCT-ACG is: UTG-CGC-GUA-ACA-GCA-GAU-CCA-AAG-CUA-UAU-AAU-CGA-UGC


A strand of DNA contains the base sequence AGTT. What is the sequence of the complementary strand of DNA?

The complementary strand of DNA for the sequence AGTT would be TCAA. In DNA, adenine pairs with thymine and guanine pairs with cytosine. So the complementary base for A is T, G is C, T is A, and T is A.


If anticodon on trna is gua what were the nucliotide coded by DNA?

GTA. What ever is on the tRNA will also be on the DNA codon. You can also work this out backwards. tRNA Anticodon reads GUA mRNA codon reads CAU DNA reads GTA


If a DNA stand sequence tagcaagc what will be the complimentary strand?

The complementary strand to tagcaagc would be ATCGTTCG. In DNA, adenine (A) pairs with thymine (T), while cytosine (C) pairs with guanine (G). So, the complementary bases are matched accordingly to form the opposite strand.

Related Questions

If this strand of DNA were used GTA CA what would be the complementary DNA produced?

CAT GT. -APEX Learning


What is the complementary DNA of atgcatgta-3'?

The complementary DNA strand of ATG-CAT-GTA-3' is TAC-GTA-CAT-5'.


If the sequence of nitrogenous bases is one standard of DNA is gta-gca the sequence of bases on its complementary DNA stand would be?

The complementary DNA strand is formed by pairing adenine (A) with thymine (T) and cytosine (C) with guanine (G). Therefore, if one strand has the sequence gta-gca, the complementary strand would have the sequence cat-cgt.


What is the complementary strand of DNA to catttggga?

Gta aac cct


A gene has the base sequence that starts with TCG GAC CAT CGA a) What would be the complementary DNA strand formed from this DNA ing?

The complementary DNA strand would be AGC CTG GTA GCT. In DNA, adenine pairs with thymine and cytosine pairs with guanine. Therefore, the complementary strand is formed by replacing each base with its complementary base.


What is the complementary DNA for GTA CA?

The complementary DNA for the sequence GTA CA can be determined by pairing each nucleotide with its corresponding partner: G (guanine) pairs with C (cytosine), T (thymine) pairs with A (adenine), and A (adenine) pairs with T (thymine). Thus, the complementary DNA sequence for GTA CA is CAT GT.


What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?

During transcription, the DNA template is used to create a complementary strand of mRNA (messenger RNA). An A on the DNA template is complementary to a U on the mRNA, T to A and C to G. Therefore the complementary mRNA of TAC-GCG-CAT-TGT-CGT-CTA-GGT-TTC-GAT-ATA-TTA-GCT-ACG is: UTG-CGC-GUA-ACA-GCA-GAU-CCA-AAG-CUA-UAU-AAU-CGA-UGC


A strand of DNA contains the base sequence AGTT. What is the sequence of the complementary strand of DNA?

The complementary strand of DNA for the sequence AGTT would be TCAA. In DNA, adenine pairs with thymine and guanine pairs with cytosine. So the complementary base for A is T, G is C, T is A, and T is A.


If anticodon on trna is gua what were the nucliotide coded by DNA?

GTA. What ever is on the tRNA will also be on the DNA codon. You can also work this out backwards. tRNA Anticodon reads GUA mRNA codon reads CAU DNA reads GTA


If a DNA stand sequence tagcaagc what will be the complimentary strand?

The complementary strand to tagcaagc would be ATCGTTCG. In DNA, adenine (A) pairs with thymine (T), while cytosine (C) pairs with guanine (G). So, the complementary bases are matched accordingly to form the opposite strand.


What RNA triplet would match DNA triplet GTA?

The Rna triplet codon GUA, Thymine being replaced by Uracil in all Rna's.


How many GTAgames were made?

The GTA games produced are: GTA I GTA London GTA II GTA III GTA: Vice City GTA Advance (for Game Boy Advance) GTA: San Andreas GTA: Liberty City Stories GTA: Vice City Stores (for the PSP) GTA: IV GTA: Chinatown Wars GTA: Episodes from Liberty City The Lost & The Damned The Ballad of Gay Tony