0
Verified answer
CAT GT.
-APEX Learning
Nathan Fatiga
Nathan Fatiga
A strand of DNA contains the base sequence AGTT. What is the sequence of the complementary strand of DNA?
It is wrong. The corresponding DNA strand is: 5' tgc gtg act 3' because you have to do the complementary and then revert it.
What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?
During transcription, the DNA template is used to create a complementary strand of mRNA (messenger RNA). An A on the DNA template is complementary to a U on the mRNA, T to A and C to G. Therefore the complementary mRNA of TAC-GCG-CAT-TGT-CGT-CTA-GGT-TTC-GAT-ATA-TTA-GCT-ACG is: UTG-CGC-GUA-ACA-GCA-GAU-CCA-AAG-CUA-UAU-AAU-CGA-UGC
If a DNA stand sequence tagcaagc what will be the complimentary strand?
The complimentary strand of DNA would have the sequence: tacggctagttgg
If anticodon on trna is gua what were the nucliotide coded by DNA?
GTA. What ever is on the tRNA will also be on the DNA codon. You can also work this out backwards. tRNA Anticodon reads GUA mRNA codon reads CAU DNA reads GTA
What is the complementary DNA strand for t-a-c c-g-g a-t-g c-c-a g-a-t c-a-a a-t-c?
t-t-a-c-g-g-t-a-g-c-t-t is the complementary strand. Adenine joins with Thymine (with two hydrogen bonds) and Cytosine joins with Guanine (with three hydrogen bonds)
If this strand of DNA were used GTA CA what would be the complementary DNA produced?
CAT GT. -APEX Learning
What is the complementary DNA of atgcatgta-3'?
The complementary DNA strand of ATG-CAT-GTA-3' is TAC-GTA-CAT-5'.
What is the complementary strand of DNA to catttggga?
Gta aac cct
A strand of DNA contains the base sequence AGTT. What is the sequence of the complementary strand of DNA?
It is wrong. The corresponding DNA strand is: 5' tgc gtg act 3' because you have to do the complementary and then revert it.
What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?
During transcription, the DNA template is used to create a complementary strand of mRNA (messenger RNA). An A on the DNA template is complementary to a U on the mRNA, T to A and C to G. Therefore the complementary mRNA of TAC-GCG-CAT-TGT-CGT-CTA-GGT-TTC-GAT-ATA-TTA-GCT-ACG is: UTG-CGC-GUA-ACA-GCA-GAU-CCA-AAG-CUA-UAU-AAU-CGA-UGC
If a DNA stand sequence tagcaagc what will be the complimentary strand?
The complimentary strand of DNA would have the sequence: tacggctagttgg
If anticodon on trna is gua what were the nucliotide coded by DNA?
GTA. What ever is on the tRNA will also be on the DNA codon. You can also work this out backwards. tRNA Anticodon reads GUA mRNA codon reads CAU DNA reads GTA
What RNA triplet would match DNA triplet GTA?
The Rna triplet codon GUA, Thymine being replaced by Uracil in all Rna's.
How many GTAgames were made?
The GTA games produced are: GTA I GTA London GTA II GTA III GTA: Vice City GTA Advance (for Game Boy Advance) GTA: San Andreas GTA: Liberty City Stories GTA: Vice City Stores (for the PSP) GTA: IV GTA: Chinatown Wars GTA: Episodes from Liberty City The Lost & The Damned The Ballad of Gay Tony
Is gnd theft auto made by xbox360?
The GTA series of games are produced by Rockstar. Games in the GTA series like GTA IV and Episodes From Liberty City (The Lost & Damned, The Ballad Of Gay Tony), are available on the Xbox 360 format.
How many 88 GTAwere made?
11214 Pontiac Trans Am GTA's were produced in 1988 including 718 notchbacks
What Grand Theft Auto game is the best?
In my opinion it would be GTA IV & the expansions hopefully GTA 5 will be good as well.
