0
C. T. Vivian was born on July 28, 1924.
Wiki User
∙ 13y ago
Add your answer:
Earn +20 pts
What is Terrence 'T. C. ' Carson's birthday?
Terrence 'T. C. ' Carson was born on November 19, 1958.
When is t pizim birthday?
his birthday is in september, september 26
When did C. T. Bate die?
C. T. Bate died in 1889.
When was C. T. Onyekwelu born?
C. T. Onyekwelu was born in 1898.
What is T. A. Barron's birthday?
T. A. Barron was born on March 26, 1952.
How many vivians are in the world?
There are so many Vivians in the world no one knows.
What is T. C. Cannon's birthday?
T. C. Cannon was born on September 27, 1946.
What is Terrence 'T. C. ' Carson's birthday?
Terrence 'T. C. ' Carson was born on November 19, 1958.
What is vivians favorite color?
his favourite colour is blue and white
What is the DNA replacation for t t c g a g a c t t a g t c g g a t g t g a a g t g g t g a t t?
a a g c t c t g a a t c a g c c t a c a c t t c a c c a c t a a.T, which stands for Thymine, only "goes" with A (Adanine). C, which stands for cytosine, only "goes" with G (Guanine). Therefore, the replication for it would be reversed.
What is the nonsense strand of DNA sequence t-a-c-c-a-a-g-c-t-a-c-c-t-a-t-t-a-a-c-c-g?
atggttcgatggataattggc
What fairy tale does Kit compare Vivians life to in Pretty Woman?
Cinderella
What is the complementary DNA strand for t-a-c c-g-g a-t-g c-c-a g-a-t c-a-a a-t-c?
t-t-a-c-g-g-t-a-g-c-t-t is the complementary strand. Adenine joins with Thymine (with two hydrogen bonds) and Cytosine joins with Guanine (with three hydrogen bonds)
What is a complementary DNA strand using a t t g c c a g c?
t a a c g g t c g
What is T-Pains birthday?
T-pains birthday is semptember 30th
What nucleotide sequence would represent the complimentary DNA strand to the following a g g c t c a g t c t a g c?
t c c g a g t c a g a t c g
How many sandwiches can you make out of ham turkey roastbeef American cheese Swiss cheese and cheddar cheese?
24 different ways. wow that took a while turkey- TU cheese- C lettuce- L tomato- T Tu, C, L, T Tu, C, T L Tu, L,C,T Tu,L,T,C Tu,C,T,L Tu,C,L,T C,TU,L,T C,TU,T,L C,L,TU,T C,L,T,TU C,T,L,TU C,T,TU,L L,TU,T,C L,TU,C,T L,C,TU,T L,C,T,TU L,T,TU,C L,T,C,TU T,TU,C,L T,TU,L,C T,L,TU,C T,L,C,TU T,C,TU,L T,C,L,TU
