answersLogoWhite

0

atggttcgatggataattggc

User Avatar

Wiki User

12y ago

What else can I help you with?

Continue Learning about Biology

A fragment of a strand of nucleic acid isolated from a silk moth species contains the base sequence CAGACT The strand must be from?

The base sequence CAGACT corresponds to the DNA strand, and it would be complementary to the RNA strand with the sequence GUCUGA. Therefore, the original strand is the DNA strand.


Complementary dna sequence?

A complimentary DNA sequence is the genetic code on the partner strand that aligns with and corresponds to (matches) the code on the primary strand. Each nucleotide has a match, A matches T and C matches G, therefore the complimentary sequence for ATCGA is TAGCT.


What is the 2nd stand matching DNA?

The 2nd strand matching DNA refers to the strand that can pair with the original DNA sequence through complementary base pairing. In DNA replication, this matching strand is synthesized by DNA polymerase according to the sequence on the original template strand.


Difference between sense and anti sense strands of DNA?

The sense strand of DNA is the strand that has the same sequence as the mRNA that is transcribed from DNA. The antisense strand is the complementary strand of the sense strand, which is used as a template for mRNA synthesis. The mRNA is transcribed from the antisense strand and contains the same sequence as the sense strand.


Which base sequence would be found on the complentary strand of DNA?

If the base sequence on one strand of DNA is A-T-G-C, then the complementary strand would have the sequence T-A-C-G. In DNA, adenine pairs with thymine and guanine pairs with cytosine.

Related Questions

If one strand of DNA has the sequence atgtc what will the sequence of the second strand be?

tacag


A fragment of a strand of nucleic acid isolated from a silk moth species contains the base sequence CAGACT The strand must be from?

The base sequence CAGACT corresponds to the DNA strand, and it would be complementary to the RNA strand with the sequence GUCUGA. Therefore, the original strand is the DNA strand.


What sequence is the sequence of the complementary strand of DNA?

its tcaa


Complementary dna sequence?

A complimentary DNA sequence is the genetic code on the partner strand that aligns with and corresponds to (matches) the code on the primary strand. Each nucleotide has a match, A matches T and C matches G, therefore the complimentary sequence for ATCGA is TAGCT.


What is the 2nd stand matching DNA?

The 2nd strand matching DNA refers to the strand that can pair with the original DNA sequence through complementary base pairing. In DNA replication, this matching strand is synthesized by DNA polymerase according to the sequence on the original template strand.


What is the base sequence for a DNA strand when given the sequence for a mRNA strand?

To determine the base sequence of a DNA strand from a given mRNA sequence, you need to consider that mRNA is synthesized from the DNA template strand through a process called transcription. The mRNA bases pair with their complementary DNA bases, where adenine (A) pairs with thymine (T), uracil (U) in mRNA pairs with adenine (A) in DNA, cytosine (C) pairs with guanine (G), and guanine (G) pairs with cytosine (C). Therefore, to find the DNA base sequence, you can convert the mRNA sequence to its corresponding DNA sequence by replacing U with A and reversing the order to get the complementary DNA strand.


If you had a small single strand of DNA with the nucleotide sequence cagtact what would the sequence be for the other DNA strand?

The complementary DNA strand would be GTACTGA. In DNA, adenine pairs with thymine and cytosine pairs with guanine.


Difference between sense and anti sense strands of DNA?

The sense strand of DNA is the strand that has the same sequence as the mRNA that is transcribed from DNA. The antisense strand is the complementary strand of the sense strand, which is used as a template for mRNA synthesis. The mRNA is transcribed from the antisense strand and contains the same sequence as the sense strand.


If the DNA sequence is TAG what is the sequence of the complementary strand of tRNA?

auc


Inverted repeat sequence in a single strand DNA?

cruciform dna


A strand of dna contains the base sequence AGTTwhat is the sequence of the complementary strand of DNA?

tcaa --remember a attracts t while c attracts g


What is the complementary base sequence of the DNA strand if the template strand reads TTGCACG?

The complementary base sequence of a DNA strand is formed by pairing adenine (A) with thymine (T) and cytosine (C) with guanine (G). For the template strand TTGCACG, the complementary sequence would be AACGTGC.