0
What is the complementary DNA strand for t-a-c c-g-g a-t-g c-c-a g-a-t c-a-a a-t-c?
Wiki User
∙ 14y ago
t-t-a-c-g-g-t-a-g-c-t-t is the complementary strand. Adenine joins with Thymine (with two hydrogen bonds) and Cytosine joins with Guanine (with three hydrogen bonds)
Wiki User
∙ 15y ago
Add your answer:
Earn +20 pts
What is the complementary DNA for TAC GG?
The complementary strand of this DNA sequence is... A T G C T A A C C
Are the two strands of DNA identical or complementary?
I don't know what you mean by complementary, so I'll use an example. If a section of one strand of DNA is ATC GGA TAC ACC, then the other will be (in the same direction) TAG CCT ATG TGG If you are looking for the messenger RNA code, change all the Ts to Us in the second code of my answer. Hope this helps!
What is the nucleotide sequence of the complementary strand of the dna molecule t t c g a a t t g c?
The sequence of nucleotides of the complementary strand will be the nucleotides which bind to the nucleotides of the template. In DNA, adenine binds to thymine and cytosine binds to guanine. The complementary strand will therefore have an adenine where the template strand has a thymine, a guanine where the template has a cytosine, etc. For example: If the template strand is ATG-GGC-CTA-GCT Then the complementary strand would be TAC-CCG-GAT-CGA
What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?
During transcription, the DNA template is used to create a complementary strand of mRNA (messenger RNA). An A on the DNA template is complementary to a U on the mRNA, T to A and C to G. Therefore the complementary mRNA of TAC-GCG-CAT-TGT-CGT-CTA-GGT-TTC-GAT-ATA-TTA-GCT-ACG is: UTG-CGC-GUA-ACA-GCA-GAU-CCA-AAG-CUA-UAU-AAU-CGA-UGC
Along one strand of a DNA double helix is the nucleotide sequence ggcataggt what is the sequence for the mRNA strand?
5`... ccagattg ... 3` 3`... ggtctaac ... 5`Remember always A complementarly binds with t with a double bond (hydrogens bonds)(a=t) in the same way g with c by means of 3hydrogen bonds between them.....
What is the complementary DNA of atgcatgta-3'?
The complementary DNA strand of ATG-CAT-GTA-3' is TAC-GTA-CAT-5'.
What is the complementary DNA for TAC GG?
The complementary strand of this DNA sequence is... A T G C T A A C C
What is the complementary strand to AGTCACGGTATCTA?
give the complementary DNA sequence of 5' atg ctt gca cca gtg tga aaa agg gcg?
Are the two strands of DNA identical or complementary?
I don't know what you mean by complementary, so I'll use an example. If a section of one strand of DNA is ATC GGA TAC ACC, then the other will be (in the same direction) TAG CCT ATG TGG If you are looking for the messenger RNA code, change all the Ts to Us in the second code of my answer. Hope this helps!
What is the nucleotide sequence of the complementary strand of the dna molecule t t c g a a t t g c?
The sequence of nucleotides of the complementary strand will be the nucleotides which bind to the nucleotides of the template. In DNA, adenine binds to thymine and cytosine binds to guanine. The complementary strand will therefore have an adenine where the template strand has a thymine, a guanine where the template has a cytosine, etc. For example: If the template strand is ATG-GGC-CTA-GCT Then the complementary strand would be TAC-CCG-GAT-CGA
If this strand of DNA was used what would be the complementary DNA produced tac gg?
AGTCG (I'm assuming your strand was written in the normal 5' to 3' order, and I wrote mine in that order as well, which means the last residue in my strand pairs with the first residue in your strand, and vice versa).
Which is the correct transcribed RNA strand for the DNA strand agc caa atg?
ucg guu uac
What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?
During transcription, the DNA template is used to create a complementary strand of mRNA (messenger RNA). An A on the DNA template is complementary to a U on the mRNA, T to A and C to G. Therefore the complementary mRNA of TAC-GCG-CAT-TGT-CGT-CTA-GGT-TTC-GAT-ATA-TTA-GCT-ACG is: UTG-CGC-GUA-ACA-GCA-GAU-CCA-AAG-CUA-UAU-AAU-CGA-UGC
Along one strand of a DNA double helix is the nucleotide sequence ggcataggt what is the sequence for the mRNA strand?
5`... ccagattg ... 3` 3`... ggtctaac ... 5`Remember always A complementarly binds with t with a double bond (hydrogens bonds)(a=t) in the same way g with c by means of 3hydrogen bonds between them.....
What is the correct DNA complement of the DNA strand 5 g a t c g g t a c a g t g 3?
In DNA, A binds to T and C binds to G Therefore the complementary DNA sequence to 5'-GAT-CGG-TAC-AGT-G-3' is: 3'-CTA-GCC-ATG-TCA-C-5'
What is the complementary stand to this dna molecule g a t c c a t g a g t t a c?
Gatccatgagttac ctaggtactcaatg
If this strand of DNA were used what would be the complementary DNA produced CGA CT?
AGTCG (I'm assuming your strand was written in the normal 5' to 3' order, and I wrote mine in that order as well, which means the last residue in my strand pairs with the first residue in your strand, and vice versa).
