0
There is a ladder leaning against a wall a person climbing this ladder is using the ladder as?
Wiki User
∙ 14y ago
Yes, of course, he was using the ladder support to travel. It is used to improve the thoughts and also extra activities to make a successful growth. SlideEgg offers the Editable Ladder PPT Template For Presentation.
Ishwarya
Wiki User
∙ 14y agoThe ladder is being used as a ramp.
Or just as a ladder.
Add your answer:
Earn +20 pts
What are the forces distance and work done of a person climbing a ladder up a tower crane?
Work done = Force x Distance.So if the person weighs 700 Newtons, and they climb 10m on the ladder, then the work done would be :700 x 10 = 7000 joules.Work Done is a form of energy, and so is always measured in joules.And be sure to convert mass (in kilograms) to weight (in Newtons) before calculating Work Done.
What does a DNA nucleotide look like?
TCCAAGAACCTACATGTTCGCGTGTTCAGCGTCCATTTCAGTATTTAGCATAAATTTGAAGAGCCGAATGGCAGTTTTGGGAGGGACACGTTGTTTTAAAAGAAGCCTTCACGAAATTGTGACCGGTCTGGACTGAAAGTACCACGGATATCTAGCAGAAAACTAAGATTCCGCCAACCTTCTCTGTTTGCCTATGACCAACAGCATCTCAGGGT
A person who received a vaccine against?
catches one of these diseases, the disease may be milder.
How would the velocity of a person be determined if they were walking against the wind?
Basically velocity is speed in a specific direction. So just the speed of the person when waking in the wind with a specific direction.
Where is the effort and the load and the fulcrum on a ladder?
Principally, a lever is a board, with some kind of object on one side that you want to move up, this it the load. and the effort is the force you exert either, down on the other side of the fulcrum, or up on the same side. there are three classes of levers, class 1 class 2 and class 3 class one, look at a seesaw, the fulcrum is the part holding it up in the middle, this is it's central balanceing point, weight of one person on one side will push down and make the other side go up, but if there are two people, the one that weighs more will go down because he has the most weight pressing down on his side. class 2, imagine having the same seesaw, but noibody on it, now sombody stands on one side, and then walks closer to the fulcrum and stays there, if you hold the far end and puch up, you are exerting force on the same side of the fulcrum, but your pushing him up. if you can move the fulcrum farther away from the person your pushing up, it will take less effort to push him just as high. class three, the seesaw has nobody on it, your friend steps onto one side of the farthest point, and you start pushing up from the same side of the fulcrum, but the different side of him, it's a class 2, but you are closer to the fulcrum then the weight, this is a class three. examples: class 1: seesaw (the way kids play on them) class 2: I can't think of a good example. class 3: catapult >.<
What kind of energy does a person climbing a ladder have plzzz answer?
A person climbing a ladder is using mechanical energy, if you are talking about types of energy.
How do ladders work?
The main purpose of a ladder is to allow people to get higher than they can reach. A ladder works by leaning it up against a solid surface and then the person climbs the ladder using the rungs.
What is Third person singular present progressive tense of the word climb?
is climbing eg He is climbing the corporate ladder
A ladder leaning against a wall makes a 60 degree angle with the ground When is it more likely to slip when a person stands on the ladder near the top or near the bottom Explain?
near the bottom.because the net force is equal to zero
How much work is done when a 70kg person climbs a ladder meters tall?
At least 3,500 joules, if his climbing effort is 100% efficient, but probably more than that.
The policy of survival of the fittest in the workplace is known as what?
The policy of survival of the fittest in the workplace is known as climbing the ladder of success. Each person must watch out for their own job.
What can happen if you walk under a ladder?
The ladder could fall on you. The person on the ladder could fall on you. You could knock the person on the ladder off it. The person on the ladder could drop something on you.
What form of energy is used when a person is climbing a ladder?
The person will use the energy of his muscles to do that. This energy comes from the food eaten by people.
Who invented the Scaling ladder?
The scaling ladder was not invented by one specific person. It has been used as a tool for climbing and accessing heights for centuries. Different variations and designs of scaling ladders have been used by different cultures and civilizations throughout history.
When a person carries a load on his head and climbs up a ladder what effort is used in energy terms.?
When a person climbs a ladder, his muscles provide the energy (work) to raise the person's weight from the ground to the top of the ladder. When the person climbs a ladder carrying a load in addition to his body, his muscles provide the energy (work) to raise his weight from the ground to the top of the ladder, plus the additional energy (work) to raise the load from the ground to the top of the ladder. The more weight goes up the ladder, the more work is done. Of that you can be positive.
What are the forces distance and work done of a person climbing a ladder up a tower crane?
Work done = Force x Distance.So if the person weighs 700 Newtons, and they climb 10m on the ladder, then the work done would be :700 x 10 = 7000 joules.Work Done is a form of energy, and so is always measured in joules.And be sure to convert mass (in kilograms) to weight (in Newtons) before calculating Work Done.
What is abseil climbing?
a big fat person
