answersLogoWhite

0

the answer is:
"O"
sorry but I forgot why.

User Avatar

Wiki User

16y ago

What else can I help you with?

Related Questions

The next letter in the sequence would be A F Z U G L T?

O


What is the next letter in the sequences Select the next letter in the sequence A F Z U G L T?

k


Select the next letter in the sequence A F Z U G L T?

A is five letters before F Z is five letters after U G is five letters before L T is five letters after _ Answers is the letter O


Next letter in sequence A F Z U G L T?

* A to F is 5 letters up from start of alphabet * Z to U is 5 letters down from end of alphabet * G to L is 5 letters up from start of alphabet * T to O is 5 letters down from end of alphabet


What is the amino acid sequence for t a c a c c t t g g c g a c g a c t?

Before we look at the complimentary mRNA sequence of the given DNA sequence, let us remember that RNA contains uracil (U) in place of Thiamine (T) The querry sequence is: t-a-c-c-t-c-g-c-a-a-c-t So the mRNA sequence would be: A U G G A G C G U U G A


What letter comes next in this sequence A O E A O T F?

G


What is the next letter in A F Z U G L T?

o


What is the nonsense strand of DNA sequence t-a-c-c-a-a-g-c-t-a-c-c-t-a-t-t-a-a-c-c-g?

The nonsense strand of the given DNA sequence T-A-C-C-A-A-G-C-T-A-C-C-T-A-T-T-A-A-C-C-G is T-A-G-G-T-T-C-G-A-T-G-G-A-T-A-A-T-G-G-C. This sequence represents the complementary base pairs to the original sequence, following the A-T and G-C base pairing rule.


What letter comes next in the sequence d r m f s l t?

d


What 4letter word can you spell with s a z f l o t a b s g?

The 4-letter word you can spell with the letters s, a, z, f, l, o, t, a, b, and g is "boat."


How do you replicate t t c g a g a c t t a g t c g g a t g t g a a g t g g t g a t t?

To replicate the DNA sequence provided (ttcgagacttagtcggatgtgaagtgg tgatt), you would need to use a DNA polymerase enzyme and a primer with a complementary sequence to start the replication process. The primer will bind to the target sequence and direct the addition of nucleotides to form a new DNA strand that is complementary to the original sequence. The result will be two identical DNA strands with the same sequence as the original.


What is the complementary sequence for this DNA c-t-a-a-g-t-c?

To find the complementary sequence for a given DNA sequence, you need to match each nucleotide with its complementary base according to the base-pairing rules. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Given the DNA sequence: C - T - A - A - G - T - C The complementary sequence would be: G - A - T - T - C - A - G