answersLogoWhite

0

This is a very simple question that has a rather complicated answer. Marble is typically more than 95% calcium carbonate, perhaps even 99% calcium carbonate, and calcium carbonate is a compound. Many of the "fine chemicals" that you would find in jars in your school laboratory would have a similar purity to a good quality marble. So marble has a good claim to be recognised as a compound.

However, if you look at a piece of marble, it has numerous very pretty stripes and blotches -- often known as "marbling" even. Clearly marble is not a homogeneous material. The small amount of various impurities in marble produce its very pretty appearance. So marble must also be recognised as a mixture.

User Avatar

Wiki User

13y ago

What else can I help you with?

Related Questions

Is chips a compound or an element?

Chips are not a compound or an element. They are a mixture of ingredients such as potatoes, oil, and seasoning.


What is the scientific name for marble chips?

The scientific name for marble chips is calcium carbonate, which is a chemical compound with the formula CaCO3.


What is the chemical name of Lays chips?

Lays chips is a mixture, not a compound.


Is a chocolate chips a homogeneous mixture?

Nope the fact that it is mixed with Chocolate Chips in the batter makes it a heterogeneous.


Are potato chips a compound mixture or element?

Potato chips, and other foods, are mixtures of compounds. Foods are made of a large variety of molecules composing the sugars, starches, salts, and liquids in them. The elements are there, of course, combining to make up the molecules, but foods are not simple elemental substances.


What is a potato chips is element compound and mixture?

Potato chips are a mixture, as they consist of various ingredients, including potatoes, oil, salt, and sometimes flavorings, all combined together without a fixed composition. Each component retains its individual properties rather than forming a chemical bond, which distinguishes mixtures from compounds. An element, on the other hand, is a pure substance consisting of only one type of atom, such as gold or oxygen, and is not applicable to potato chips.


Is mint chocolate chip ice cream a compound element or a mixture?

Mint chocolate chip ice cream is a mixture, not a compound element. It consists of various ingredients, including mint flavoring, chocolate chips, cream, sugar, and other components that retain their individual properties. Unlike a compound, where substances chemically bond to form a new substance, the ingredients in mint chocolate chip ice cream can be separated and identified individually.


What is the formula of the bubbles produce from the reaction of an acid with marble chip?

When an acid reacts with marble chips (calcium carbonate), bubbles of carbon dioxide gas are produced. The chemical reaction formula is: acid + calcium carbonate (marble chips) -> carbon dioxide gas + water + calcium salt


What is the pH of marble chips?

pH is measured only in solutions or liquids. Marble chips has not a pH.


How could you separate a mixture of rice and marbles?

If we're talking about normal rice-sized rice and standard glass marbles, it's not much of a problem; it would be like separating horses from cats. So let's suppose the "marbles" are chips of metamorphic limestone, cunningly carved to resemble grains of rice. 1. Since rice is less dense that marble, we could irrigate (flush with water) the rice-marble mixture. At some velocity, the rice would be washed away while the marble would remain. 2. We could just a stream of air the same way. 3. We could expose the mixture to a colony of ants, who would carry away the rice and leave the marble.


Is chocolate shake an element or a compound or a mixture?

It's an element. An element is a substance entirely consisting of one element on the periodic table like a gold ring or the oxygen in a oxygen tank. A compound is a substance that consists of chemicly bonded elements like water (H2O) or salt (NaCl). A Mixture is just a mix of various compounds and elements without a chemical bond. Examples of this are coins. Chocolate Shakes however are elements, and are number 55 on the periodic table with the symbol of Cs. I hope this answered your question. =)


What is the pH of marble?

pH is measured only in solutions or liquids. Marble chips has not a pH.

Trending Questions
How many bacteria strains or substrains have been recorded in NCBI taxonomic classification? Which has more mass the air that we inhale or the same volume of air we exhale? What are examples of atomic absorption spectroscopy? Where Pluto is which moon is the biggest moon hydra or nix? Can you help rich and Maggie understand what is going on with the weather to create the big wet storm? What is the molarity of an hcl solution if 10.0ml hcl solution is titrated with 28.6ml of 0.175m naoh solution? What substance would need to be added in order to reverse the reaction? What happens a DNA nucleotide that contains guanine is accidentally substituted for a DNA nucleotide that contains thymine? What is the DNA sequence that is complementary to DNA strands of CGGCCTTCAATAGGTCCCAAA? What did Dr R. R. Radon studie? What is the difference between protozoa and protists? Why are spiracles located all along the abdomen? Which statement describes events during interphase of mitosis A Chromosomes start to coil becoming shorter and fatter. B Chromosomes line up on the equator of the spindle. C Chromatids are pulled apar? Are polysaccharides types of proteins? What are some external influences that can cause mutation? Is curdling of milk is physical change or chemical change? Where have significant oil and natural gas supplies been found in the European realm? How do you remove scuffs from hardwood floors? What is the common use of alka-seltzer? If we were going to measure the distance between your house and the store what should i use to measue it meters centimeters kilometers or millimeters?