answersLogoWhite

0

adenine and thymine, cytosine and guanine or a pairs with t and c pairs with g

User Avatar

Wiki User

14y ago

What else can I help you with?

Related Questions

What do thymine mean?

Thymine is the complementary base pair for adenine in DNA.


Is A C a legitimate base pair?

Not in DNA. In DNA the only base pairs are A-T and C-G. RNA can form non-canonical base pairings, so you might get some AC in RNA structures.


What is the complementary base pairing between adenine and thymine in DNA?

Adenine pairs with thymine in DNA through hydrogen bonds, forming a complementary base pair.


What would be the base sequence for the complementary DNA formed from CGT TA?

The base sequence for the complementary DNA would be GCA AT. Since DNA strands are complementary, the bases pair as follows: A with T, T with A, C with G, and G with C.


Do the rna nucleotides pair exactly as they were DNA replication?

No, RNA nucleotides in transcription pair with complementary DNA nucleotides according to the base pairing rules (A-U, G-C), as opposed to replicating DNA in which DNA nucleotides pair with complementary DNA nucleotides (A-T, G-C).


Guanine is a complementary base for which of these DNA nucleotides?

Guanine is a complementary base for cytosine in DNA.


What type of base pairing occur during transcriptions?

the types that occur are complementary and antiparallel. For example, DNA A will pair with RNA U and DNA C will pair with RNA G.


What are the two pairs of stable Watson-Crick complementary DNA base pair?

They are: - Adenine and thymine - Cytosine and guanine


What base pairs with Adenine in RNA?

Uracil. In normal DNA it would be Thymine, but in RNA Uracil becomes the base pair for Adenine.


What is the significance of the complementary base pair in the process of DNA replication?

The complementary base pair is important in DNA replication because it ensures that the new DNA strand is an exact copy of the original strand. This pairing allows for accurate replication of genetic information, which is crucial for maintaining the integrity of the genetic code and passing on correct information to new cells.


Uracil will pair with what other on DNA?

Uracil is the base used in messenger RNA in place of thymine, and is complementary to adenine.


What is the correct complementary DNA starnd for gacatcgttgactacggctgatc?

CTGTAGCAACTGATGCCTACTAG The complementary DNA strand is formed by pairing adenine with thymine and cytosine with guanine. Simply replace each base with its complementary pair: A with T, T with A, C with G, and G with C.