answersLogoWhite

0

The DNA strand produced from the template sequence "tac gg" would be complementary to it. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, the complementary DNA strand would be "atg cc."

User Avatar

AnswerBot

1y ago

What else can I help you with?

Related Questions

What would be the stand of complementary DNA produced by the stand of DNA ATG CGA?

The complementary DNA strand produced from the given DNA sequence ATG CGA would be TAC GCT. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base in the original strand is matched with its complementary base to form the new strand.


What strand of DNA would be produced from ATG CGA?

The strand of DNA complementary to the given sequence ATG CGA would be TAC GCT. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Thus, A pairs with T, T with A, C with G, and G with C in the complementary strand.


If this strand of DNA was used what would be the complementary DNA produced tac gg?

AGTCG (I'm assuming your strand was written in the normal 5' to 3' order, and I wrote mine in that order as well, which means the last residue in my strand pairs with the first residue in your strand, and vice versa).


The nucleotide base sequence of a strand of DNA is TAC-CGG-AGT. What is the sequence of the complementary DNA strand?

The complementary DNA strand to TAC-CGG-AGT is ATG-GCC-TCA. In DNA, adenine pairs with thymine (A-T) and cytosine pairs with guanine (C-G), so the complementary strand is created by matching these base pairs.


What strand of mRNA would be produced from the strand of DNA shown below?

The DNA strand CAT-TAG would produce a complementary mRNA strand of GUA-AUC.


What is the complementary DNA of atgcatgta-3'?

The complementary DNA strand of ATG-CAT-GTA-3' is TAC-GTA-CAT-5'.


If the base sequence on one DNA strand is ATGGCCTAG what is the sequence on the strand of the helix?

The sequence on the strand of the helix is TACCGGATC.


What would be the strand of complementary DNA produce by the strand of DNA tcg aag?

Purine- Adenine, guanine,pyrimidine- thymine, cytosineAdenine pairs with thymineGuanine pairs with cytosineTherefore the complementary strand to TCG AAG is AGC TTC=========================================================A always pairs with T, and C always pairs with G so the complementary strand is as follows:TCG AAG (Original)AGC TTC (Complementary)GCA TAT


What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?

During transcription, the DNA template is used to create a complementary strand of mRNA (messenger RNA). An A on the DNA template is complementary to a U on the mRNA, T to A and C to G. Therefore the complementary mRNA of TAC-GCG-CAT-TGT-CGT-CTA-GGT-TTC-GAT-ATA-TTA-GCT-ACG is: UTG-CGC-GUA-ACA-GCA-GAU-CCA-AAG-CUA-UAU-AAU-CGA-UGC


What is the complementary DNA for TAC GG?

The complementary strand of this DNA sequence is... A T G C T A A C C


A strand of DNA contains the base sequence AGTT. What is the sequence of the complementary strand of DNA?

The complementary strand of DNA for the sequence AGTT would be TCAA. In DNA, adenine pairs with thymine and guanine pairs with cytosine. So the complementary base for A is T, G is C, T is A, and T is A.


If the strand of DNA has the nucleotides TACCGGACCTGAAGT what would the mRNA strand be?

First of all, it is codons,not condons. MRNA would have uug auc cca. If I am not incorrect, you only use the term codons for MRNA, not in the actual DNA strand. The Anticodons would then be in the TRNA, which codes for the Amino Acids needed by the cells.