0
What else can I help you with?
What is the complementary mrna starnd to dna sequence cggatcat?
GCCUAGUA
DNA sequence acgtt will give what mRNA base sequence?
The mRNA base sequence corresponding to the DNA sequence acgtt is ugcaa. The mRNA sequence is complementary to the DNA sequence, with thymine (T) in DNA being replaced by uracil (U) in mRNA.
What is the complementary mRNA sequence to the DNA sequence A-A-T-G-G-C?
The complimentary mRNA sequence would be: U-A-A-C-G-U
What sequences of a piece of mRNA is AGUACA what is the matching sequence of the tRNA?
The mRNA sequence AGUACA corresponds to the codons that will be translated into amino acids during protein synthesis. The matching tRNA sequence, which carries the complementary anticodon, would be UCAUGU. Each tRNA molecule pairs with its corresponding mRNA codon to ensure the correct amino acid is added to the growing polypeptide chain.
What sequence of mRNA would go with the DNA sequence of act?
If the DNA sequence is ACT, the complimentary mRNA sequence would be UGA
What are the bases of mRNA coded for by this section of DNA before the mutation?
The bases of mRNA coded for by a DNA segment are complementary to the original DNA sequence. If the DNA sequences are ATCG, the corresponding mRNA bases will be UAGC.
A segment of DNA has the following sequence TTAAGGCC. Which sequence of bases would be found on the complementary strand of mRNA?
The complimentary strand of MRNA would be AAUUCCGG.
What are base sequences in tRNA called?
Anticodons
What is the A segment of DNA has the following sequence TTAAGGCC. Which sequence of bases would be found on the complementary strand of mRNA?
The complementary base pairing rule for DNA and mRNA is: A pairs with U, T pairs with A, G pairs with C, and C pairs with G. Therefore, the mRNA complementary strand for the DNA sequence TTAAGGCC would be AAUUCCGG.
A segment of DNA has the following sequence ttaaggcc which sequence of bases would be found on the complementary strand of mrna?
TGCA
The set of three nitrogen bases on tRNA that is complementary to an mRNA codon is called?
These nucleotide sequences are called anticodons.
What order of bases on mRNA will match a sequence on tRNA of UUA?
If the tRNA has the sequence UUA, then the mRNA it reads from will have the sequence complementary to UUA, which is AAU. RNA uses the nucleic acid uracil instead of the DNA counterpart, thymine.
What is the relationship between codons and anticodons?
A codon is found in the DNA sequence and in the mRNA sequence. The anticodon is the opposite sequence that would match with the sequence of the codon and allows pairing of the anticodon with the codon
What determines the sequence of bases in mRNA?
the sequence of bases in DNA
What is the complementary mrna starnd to dna sequence cggatcat?
GCCUAGUA
DNA sequence acgtt will give what mRNA base sequence?
The mRNA base sequence corresponding to the DNA sequence acgtt is ugcaa. The mRNA sequence is complementary to the DNA sequence, with thymine (T) in DNA being replaced by uracil (U) in mRNA.
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."
