0
The complimentary mRNA sequence would be: U-A-A-C-G-U
What else can I help you with?
DNA sequence acgtt will give what mRNA base sequence?
The mRNA base sequence corresponding to the DNA sequence acgtt is ugcaa. The mRNA sequence is complementary to the DNA sequence, with thymine (T) in DNA being replaced by uracil (U) in mRNA.
What is the complementary mrna starnd to dna sequence cggatcat?
GCCUAGUA
What sequence of mRNA would go with the DNA sequence of act?
If the DNA sequence is ACT, the complimentary mRNA sequence would be UGA
What is the sequence of the mRNA made from the gene TTACAGGTCCCA?
The sequence of the mRNA transcribed from the DNA gene TTACAGGTCCCA would be complementary to the template strand of the DNA. Since mRNA is synthesized using uracil (U) instead of thymine (T), the corresponding mRNA sequence would be AAUGUCCAGGGU. This sequence reflects the direct transcription of the DNA template, replacing each thymine with uracil.
In genetics what does complementary DNA mean?
Complementary DNA (cDNA) is DNA that has been copied from an mRNA through a reverse transcriptase enzyme. cDNA contains a copy of the original DNA sequence that made the mRNA - but without the introns (as these are cut out to create mRNA).
DNA sequence acgtt will give what mRNA base sequence?
The mRNA base sequence corresponding to the DNA sequence acgtt is ugcaa. The mRNA sequence is complementary to the DNA sequence, with thymine (T) in DNA being replaced by uracil (U) in mRNA.
What is the dna segment of ugauuc from mRNA?
The DNA segment complementary to the mRNA sequence "UGAUUC" would be "ACTAAG". This is because in DNA, adenine pairs with thymine and cytosine pairs with guanine. Thus, the complementary DNA sequence of the mRNA sequence is determined by replacing each base with its complementary base.
What is the complementary mrna starnd to dna sequence cggatcat?
GCCUAGUA
What sequence of mRNA would go with the DNA sequence of act?
If the DNA sequence is ACT, the complimentary mRNA sequence would be UGA
What is the A segment of DNA has the following sequence TTAAGGCC. Which sequence of bases would be found on the complementary strand of mRNA?
The complementary base pairing rule for DNA and mRNA is: A pairs with U, T pairs with A, G pairs with C, and C pairs with G. Therefore, the mRNA complementary strand for the DNA sequence TTAAGGCC would be AAUUCCGG.
A segment of DNA has the following sequence ttaaggcc which sequence of bases would be found on the complementary strand of mrna?
TGCA
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."
What sequence in mRNA complements the sequence in the DNA template?
The sequence in mRNA is complementary to the DNA template, with thymine (T) in DNA being replaced by uracil (U) in mRNA. The complementary base pairing rules still apply: adenine (A) pairs with uracil (U), and guanine (G) pairs with cytosine (C).
If the DNA secquence to be transcribed is actg then the resulting mRNA sequence will be?
if the DNA sequence is A C T G then its resulting mRNA sequence will be complementary so it will be T G A C
The code of mrna directly dependent on the?
The sequence of mRNA is directly dependent on the sequence of DNA in the process of transcription. During transcription, RNA polymerase reads the DNA sequence and synthesizes a complementary mRNA strand. Changes in the DNA sequence can result in changes in the mRNA sequence, affecting the protein product that is ultimately produced.
A segment of DNA has the following sequence TTAAGGCC. Which sequence of bases would be found on the complementary strand of mRNA?
The complimentary strand of MRNA would be AAUUCCGG.
If a strand of DNA has the sequence aagctc transcription will result in?
If a strand of DNA has the sequence aagctc, transcription will result in a mRNA molecule with the complementary sequence uucgag. Transcription is the process of creating a mRNA molecule using DNA as a template.
