0
What else can I help you with?
DNA sequence acgtt will give what mRNA base sequence?
The mRNA base sequence corresponding to the DNA sequence acgtt is ugcaa. The mRNA sequence is complementary to the DNA sequence, with thymine (T) in DNA being replaced by uracil (U) in mRNA.
What is the complementary mRNA sequence to the DNA sequence A-A-T-G-G-C?
The complimentary mRNA sequence would be: U-A-A-C-G-U
What sequence of mRNA would go with the DNA sequence of act?
If the DNA sequence is ACT, the complimentary mRNA sequence would be UGA
What are the complementary mRNA and tRNA sequences for this sequence of DNA bases CGA?
The complementary mRNA sequence for the DNA sequence CGA would be GCU, as adenine (A) pairs with uracil (U) in RNA instead of thymine (T). The corresponding tRNA sequence that pairs with the mRNA GCU would be CAG, where guanine (G) pairs with cytosine (C) and cytosine (C) pairs with guanine (G). Thus, for the DNA sequence CGA, the mRNA is GCU and the tRNA is CAG.
What is the base sequence for a DNA strand when given the sequence for a mRNA strand?
To determine the base sequence of a DNA strand from a given mRNA sequence, you need to consider that mRNA is synthesized from the DNA template strand through a process called transcription. The mRNA bases pair with their complementary DNA bases, where adenine (A) pairs with thymine (T), uracil (U) in mRNA pairs with adenine (A) in DNA, cytosine (C) pairs with guanine (G), and guanine (G) pairs with cytosine (C). Therefore, to find the DNA base sequence, you can convert the mRNA sequence to its corresponding DNA sequence by replacing U with A and reversing the order to get the complementary DNA strand.
DNA sequence acgtt will give what mRNA base sequence?
The mRNA base sequence corresponding to the DNA sequence acgtt is ugcaa. The mRNA sequence is complementary to the DNA sequence, with thymine (T) in DNA being replaced by uracil (U) in mRNA.
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."
What is the complementary mRNA sequence to the DNA sequence A-A-T-G-G-C?
The complimentary mRNA sequence would be: U-A-A-C-G-U
What is the dna segment of ugauuc from mRNA?
The DNA segment complementary to the mRNA sequence "UGAUUC" would be "ACTAAG". This is because in DNA, adenine pairs with thymine and cytosine pairs with guanine. Thus, the complementary DNA sequence of the mRNA sequence is determined by replacing each base with its complementary base.
What is the A segment of DNA has the following sequence TTAAGGCC. Which sequence of bases would be found on the complementary strand of mRNA?
The complementary base pairing rule for DNA and mRNA is: A pairs with U, T pairs with A, G pairs with C, and C pairs with G. Therefore, the mRNA complementary strand for the DNA sequence TTAAGGCC would be AAUUCCGG.
A segment of DNA has the following sequence ttaaggcc which sequence of bases would be found on the complementary strand of mrna?
TGCA
A segment of DNA has the following sequence TTAAGGCC. Which sequence of bases would be found on the complementary strand of mRNA?
The complimentary strand of MRNA would be AAUUCCGG.
What sequence of mRNA would go with the DNA sequence of act?
If the DNA sequence is ACT, the complimentary mRNA sequence would be UGA
What sequence in mRNA complements the sequence in the DNA template?
The sequence in mRNA is complementary to the DNA template, with thymine (T) in DNA being replaced by uracil (U) in mRNA. The complementary base pairing rules still apply: adenine (A) pairs with uracil (U), and guanine (G) pairs with cytosine (C).
What statement best compares the base sequence of an mRNA molecule with that of the cDNA made from the mRNA?
The base sequence of cDNA is complementary to the mRNA molecule from which it is synthesized. This means that the cDNA will have the same sequence as the mRNA, except that thymine in DNA is replaced with uracil in RNA.
What order of bases on mRNA will match a sequence on tRNA of UUA?
If the tRNA has the sequence UUA, then the mRNA it reads from will have the sequence complementary to UUA, which is AAU. RNA uses the nucleic acid uracil instead of the DNA counterpart, thymine.
What are the complementary mRNA and tRNA sequences for this sequence of DNA bases CGA?
The complementary mRNA sequence for the DNA sequence CGA would be GCU, as adenine (A) pairs with uracil (U) in RNA instead of thymine (T). The corresponding tRNA sequence that pairs with the mRNA GCU would be CAG, where guanine (G) pairs with cytosine (C) and cytosine (C) pairs with guanine (G). Thus, for the DNA sequence CGA, the mRNA is GCU and the tRNA is CAG.
