0
What else can I help you with?
DNA sequence acgtt will give what mRNA base sequence?
The mRNA base sequence corresponding to the DNA sequence acgtt is ugcaa. The mRNA sequence is complementary to the DNA sequence, with thymine (T) in DNA being replaced by uracil (U) in mRNA.
What is the complementary mRNA sequence to the DNA sequence A-A-T-G-G-C?
The complimentary mRNA sequence would be: U-A-A-C-G-U
What sequence of mRNA would go with the DNA sequence of act?
If the DNA sequence is ACT, the complimentary mRNA sequence would be UGA
What is the sequence of the mRNA made from the gene TTACAGGTCCCA?
The sequence of the mRNA transcribed from the DNA gene TTACAGGTCCCA would be complementary to the template strand of the DNA. Since mRNA is synthesized using uracil (U) instead of thymine (T), the corresponding mRNA sequence would be AAUGUCCAGGGU. This sequence reflects the direct transcription of the DNA template, replacing each thymine with uracil.
What is the nucleotides sequence of the mRNA strand you build?
The nucleotide sequence of the mRNA strand is determined by the DNA template strand during transcription. If the DNA template sequence is, for example, 3'-ATCGTAGC-5', the corresponding mRNA sequence synthesized would be 5'-UAGCAUCG-3'. The mRNA sequence consists of complementary RNA nucleotides, where adenine (A) pairs with uracil (U) and cytosine (C) pairs with guanine (G).
DNA sequence acgtt will give what mRNA base sequence?
The mRNA base sequence corresponding to the DNA sequence acgtt is ugcaa. The mRNA sequence is complementary to the DNA sequence, with thymine (T) in DNA being replaced by uracil (U) in mRNA.
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."
What is the complementary mRNA sequence to the DNA sequence A-A-T-G-G-C?
The complimentary mRNA sequence would be: U-A-A-C-G-U
What is the dna segment of ugauuc from mRNA?
The DNA segment complementary to the mRNA sequence "UGAUUC" would be "ACTAAG". This is because in DNA, adenine pairs with thymine and cytosine pairs with guanine. Thus, the complementary DNA sequence of the mRNA sequence is determined by replacing each base with its complementary base.
What is the A segment of DNA has the following sequence TTAAGGCC. Which sequence of bases would be found on the complementary strand of mRNA?
The complementary base pairing rule for DNA and mRNA is: A pairs with U, T pairs with A, G pairs with C, and C pairs with G. Therefore, the mRNA complementary strand for the DNA sequence TTAAGGCC would be AAUUCCGG.
A segment of DNA has the following sequence ttaaggcc which sequence of bases would be found on the complementary strand of mrna?
TGCA
A segment of DNA has the following sequence TTAAGGCC. Which sequence of bases would be found on the complementary strand of mRNA?
The complimentary strand of MRNA would be AAUUCCGG.
What sequence of mRNA would go with the DNA sequence of act?
If the DNA sequence is ACT, the complimentary mRNA sequence would be UGA
What sequence in mRNA complements the sequence in the DNA template?
The sequence in mRNA is complementary to the DNA template, with thymine (T) in DNA being replaced by uracil (U) in mRNA. The complementary base pairing rules still apply: adenine (A) pairs with uracil (U), and guanine (G) pairs with cytosine (C).
What statement best compares the base sequence of an mRNA molecule with that of the cDNA made from the mRNA?
The base sequence of cDNA is complementary to the mRNA molecule from which it is synthesized. This means that the cDNA will have the same sequence as the mRNA, except that thymine in DNA is replaced with uracil in RNA.
What order of bases on mRNA will match a sequence on tRNA of UUA?
If the tRNA has the sequence UUA, then the mRNA it reads from will have the sequence complementary to UUA, which is AAU. RNA uses the nucleic acid uracil instead of the DNA counterpart, thymine.
If the DNA secquence to be transcribed is actg then the resulting mRNA sequence will be?
if the DNA sequence is A C T G then its resulting mRNA sequence will be complementary so it will be T G A C
