answersLogoWhite

0

If TACGTT is read 5'-TACGTT-3' then the complimentary strand will read 5'-AACGTA-3'. Since the template strand is traditionally written in the 5' to 3' direction then the complimentary strand, written in the same manner, would be AACGTA not ATGCAA. The four bases, adenine(A), thyamine(T), cytosin(C), and guanine(G) bond together in pairs. A - T, and C - G. They do not pair with any other base unless in the case of RNA, when thyamine is replaced with uracil.

User Avatar

Wiki User

17y ago

What else can I help you with?

Continue Learning about Natural Sciences

How many bases does a double helix have after the complementary strand is added?

A double helix has twice the number of bases in one strand, so after adding the complementary strand, the double helix will have the sum of the bases in both strands. This is because each base pairs with its complementary base (A with T, and G with C) across the two strands.


What stand of DNA has the same bases agtaac?

The DNA strand that has the same bases as "AGTAAC" would be its complementary strand, which is "TCATTG." In DNA, adenine (A) pairs with thymine (T), and guanine (G) pairs with cytosine (C), so each base on one strand is matched by its complementary base on the opposite strand.


What would be the complimentary bases for a.t.c.g.c.a.t.t. for a dna strand?

A binds with T, G binds with C.Therefore the complementary strand for ATCGCATT would be TAGCGTAA.


If the sequence of nitrogenous bases is one standard of DNA is gta-gca the sequence of bases on its complementary DNA stand would be?

The complementary DNA strand is formed by pairing adenine (A) with thymine (T) and cytosine (C) with guanine (G). Therefore, if one strand has the sequence gta-gca, the complementary strand would have the sequence cat-cgt.


What is the sequence of the template strand if a nontenplate strand has the sequence 5'ATGGGCGC3'?

To determine the sequence of the template strand, you need to find the complementary bases to the nontemplate strand (5' ATGGGCGC 3'). The complementary bases are A-T and G-C. Therefore, the sequence of the template strand will be 3' TACCCGCG 5', written in the opposite direction to maintain the 5' to 3' orientation.

Related Questions

Which enzyme is responsible for adding complementary DNA bases to an exposed DNA strand?

The enzyme responsible for adding complementary DNA bases to an exposed DNA strand is DNA polymerase.


What are the bases on the complimentary strand of bases for strand with the bases AAGCCA?

The complementary strand for bases AAGCCA would be TTCGGT. In DNA, adenine pairs with thymine and guanine pairs with cytosine.


How many bases does a double helix have after the complementary strand is added?

A double helix has twice the number of bases in one strand, so after adding the complementary strand, the double helix will have the sum of the bases in both strands. This is because each base pairs with its complementary base (A with T, and G with C) across the two strands.


When DNA replicates the new strand is what to the original strand?

The new strand is complementary to the original strand. This means that the bases on the new strand pair with the bases on the original strand according to the rules of base pairing (A with T and G with C).


What stand of DNA has the same bases agtaac?

The DNA strand that has the same bases as "AGTAAC" would be its complementary strand, which is "TCATTG." In DNA, adenine (A) pairs with thymine (T), and guanine (G) pairs with cytosine (C), so each base on one strand is matched by its complementary base on the opposite strand.


What would be the complimentary bases for a.t.c.g.c.a.t.t. for a dna strand?

A binds with T, G binds with C.Therefore the complementary strand for ATCGCATT would be TAGCGTAA.


If the sequence of nitrogenous bases is one standard of DNA is gta-gca the sequence of bases on its complementary DNA stand would be?

The complementary DNA strand is formed by pairing adenine (A) with thymine (T) and cytosine (C) with guanine (G). Therefore, if one strand has the sequence gta-gca, the complementary strand would have the sequence cat-cgt.


What is the sequence of the template strand if a nontenplate strand has the sequence 5'ATGGGCGC3'?

To determine the sequence of the template strand, you need to find the complementary bases to the nontemplate strand (5' ATGGGCGC 3'). The complementary bases are A-T and G-C. Therefore, the sequence of the template strand will be 3' TACCCGCG 5', written in the opposite direction to maintain the 5' to 3' orientation.


How do you indicate the secuence of the templates strand if a nontemplate strand has the sequence 5' ATGGGGCGC 3'?

To indicate the sequence of the template strand based on the nontemplate strand (5' ATGGGGCGC 3'), you need to determine the complementary bases and reverse the direction. The complementary bases are: T for A, C for G, and G for C. Therefore, the template strand sequence will be 3' TACCCCGCG 5'.


What is the complementary section on the other strand of DNA if one strand is CTAGAAC?

The complementary section on the other strand would be GATCTTG. This is because in DNA, adenine pairs with thymine and cytosine pairs with guanine, so the complementary bases are G-C, A-T, T-A, and C-G.


Which enzyme assembles the complementary nucleotide bases during replication?

DNA polymerase is responsible for assembling complementary nucleotide bases during DNA replication. It adds nucleotides to the growing DNA strand using the existing strand as a template.


What is the DNA replication strand for ATGCATTGACGGTACCGATACATCAT?

To determine the DNA replication strand for the sequence ATGCATTGACGGTACCGATACATCAT, you need to find the complementary bases. The complementary strand would be TACGTAACCTGCCATGGCTATGTAGTA, where adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G).