answersLogoWhite

0

The sequence UUA on an mRNA chain is a codon that codes for the amino acid leucine. In the genetic code, each codon consists of three nucleotides, and UUA is one of several codons that specify leucine. This means that during protein synthesis, if the ribosome encounters UUA, it will incorporate leucine into the growing polypeptide chain.

User Avatar

AnswerBot

8mo ago

What else can I help you with?

Continue Learning about Natural Sciences

What are the sequence of the anticondons for the transfer rna of augaauggcucgaucuga?

To determine the anticodons for the given mRNA sequence (AUGAAUGGCUGAUCUGA), we first identify the codons by breaking the sequence into groups of three nucleotides: AUG, AAU, GGC, UGA, CUG. The corresponding anticodons for each of these codons, using the base pairing rules (A-U and C-G), are UAC, UUA, CCG, ACU, and GAC. Thus, the sequence of the anticodons is UAC UUA CCG ACU GAC.


What process produces the nucleotide sequence uua from the DNA sequence aat?

D


If the sequence of bases in mRNA is UUU UUA AUU GUC CCA the sequence of amino acids in the polypeptide will be?

The sequence of amino acids in the polypeptide will be Phenylalanine-Leucine-Isoleucine-Valine-Proline. This is because each group of three mRNA bases (codon) corresponds to a specific amino acid, as determined by the genetic code.


What is THE CORRRECT BASE PARING IN mRNA FOR THE FOLLOWING AATCGTA?

In mRNA, the base pairing for the DNA sequence AATCGTA is determined by the complementary RNA bases. The correct pairing would be UUA CGUA, where adenine (A) pairs with uracil (U), and cytosine (C) pairs with guanine (G), while guanine (G) pairs with cytosine (C) and thymine (T) pairs with adenine (A).


Is there only one mRNA code for each amino acid?

No, there is not just one mRNA code for each amino acid. In the genetic code, multiple codons (three-nucleotide sequences) can specify the same amino acid, a phenomenon known as redundancy or degeneracy of the genetic code. For example, the amino acid leucine is encoded by six different codons (UUA, UUG, CUU, CUC, CUA, CUG). This redundancy helps mitigate the effects of mutations in the DNA sequence.

Related Questions

What order of bases on mRNA will match a sequence on tRNA of UUA?

If the tRNA has the sequence UUA, then the mRNA it reads from will have the sequence complementary to UUA, which is AAU. RNA uses the nucleic acid uracil instead of the DNA counterpart, thymine.


What are the sequence of the anticondons for the transfer rna of augaauggcucgaucuga?

To determine the anticodons for the given mRNA sequence (AUGAAUGGCUGAUCUGA), we first identify the codons by breaking the sequence into groups of three nucleotides: AUG, AAU, GGC, UGA, CUG. The corresponding anticodons for each of these codons, using the base pairing rules (A-U and C-G), are UAC, UUA, CCG, ACU, and GAC. Thus, the sequence of the anticodons is UAC UUA CCG ACU GAC.


What process produces the nucleotide sequence uua from the DNA sequence aat?

D


If the sequence of bases in mRNA is UUU UUA AUU GUC CCA the sequence of amino acids in the polypeptide will be?

The sequence of amino acids in the polypeptide will be Phenylalanine-Leucine-Isoleucine-Valine-Proline. This is because each group of three mRNA bases (codon) corresponds to a specific amino acid, as determined by the genetic code.


What is AAT in mRNA codon?

AAT in mRNA codon represents the sequence adenine-adenine-thymine, which codes for the amino acid asparagine in protein synthesis. This codon is recognized by the corresponding tRNA molecule carrying asparagine during translation in the ribosome.


What is THE CORRRECT BASE PARING IN mRNA FOR THE FOLLOWING AATCGTA?

In mRNA, the base pairing for the DNA sequence AATCGTA is determined by the complementary RNA bases. The correct pairing would be UUA CGUA, where adenine (A) pairs with uracil (U), and cytosine (C) pairs with guanine (G), while guanine (G) pairs with cytosine (C) and thymine (T) pairs with adenine (A).


How do you draw the protein cctgaaggtacgttagttgacatgacg?

To draw the protein sequence encoded by the given DNA sequence (cctgaaggtacgttagttgacatgacg), first, you need to transcribe the DNA into mRNA by replacing thymine (T) with uracil (U), resulting in ccu-gaa-ggu-acg-uua-guu-gac-aug-acg. Then, translate the mRNA into an amino acid sequence using a codon chart, which will yield the corresponding protein sequence. Finally, you can represent the protein structure using software tools like PyMOL or Chimera, or sketch it by hand, showing the primary structure (linear sequence of amino acids) and potentially the secondary and tertiary structures based on the sequence.


How many mRNA sequences can code for the simple tripeptide sequence leu-met-tyr?

12: UUA-AUG-UAU UUA-AUG-UAC UUG-AUG-UAU UUG-AUG-UAC CUU-AUG-UAU CUU-AUG-UAC CUC-AUG-UAU CUC-AUG-UAC CUA-AUG-UAU CUA-AUG-UAC CUG-AUG-UAU CUG-AUG-UAC


What are the different codons for leucine and proline?

LeucineCUUCUCCUACUGUUAUUGProlineCCUCCCCCACCG


What is a possible base sequence for the DNA strand from which the messenger for glutathione was transcribed?

A possible base sequence for the DNA strand could be: TAC GCT TGA ACT GGC ACC TCA. This complementary sequence would transcribe into mRNA with the message for glutathione production.


What is the amino acid sequence for t a c a c c t t g g c g a c g a c t?

Before we look at the complimentary mRNA sequence of the given DNA sequence, let us remember that RNA contains uracil (U) in place of Thiamine (T) The querry sequence is: t-a-c-c-t-c-g-c-a-a-c-t So the mRNA sequence would be: A U G G A G C G U U G A


What would be the base sequence of the complementary mRNA strand?

TGCA