answersLogoWhite

0

chromatids have 4 bases cytoseine,guanine,adinine,and thymne.When the strands separate the body creates a copy of the other side of the stand to fill in the space of the base that pairs with base on the other strand like how guanine and cytosine go together and adinie and thymne connect together

User Avatar

Wiki User

14y ago

What else can I help you with?

Related Questions

What would match the DNA strand TCCGAACGTC?

The complementary DNA strand to TCCGAACGTC is AGGCTTGCAA. This is because adenine pairs with thymine and cytosine pairs with guanine in DNA.


What complementary strand of DNA would be produced from the DNA strand cgt ta?

The complementary strand of DNA to cgtta would be gcaat. This is because in DNA, cytosine pairs with guanine and thymine pairs with adenine.


What is the DNA polmerases?

DNA polymerase is an enzyme which synthetizes complementary DNA strand, according to the template strand. So if you have a single-strand DNA, DNA polymerase can sit on it and synthetize the second strand, by the pairing rules - A pairs with T, G pairs with C.


Complementary strand of DNA for gene segment gccaatgct?

The complementary DNA strand is CGTTTGATGG. A pairs with T, and G pairs with C.


If you had a small single strand of DNA with the nucleotide sequence cagtact what would the sequence be for the other DNA strand?

The complementary DNA strand would be GTACTGA. In DNA, adenine pairs with thymine and cytosine pairs with guanine.


The nucleotide base sequence of a strand of DNA is TAC-CGG-AGT. What is the sequence of the complementary DNA strand?

The complementary DNA strand to TAC-CGG-AGT is ATG-GCC-TCA. In DNA, adenine pairs with thymine (A-T) and cytosine pairs with guanine (C-G), so the complementary strand is created by matching these base pairs.


Which type of mRNA nucleotide pairs thymine in the DNA strand?

Uracil pairs with adenine in mRNA and replaces thymine in the DNA strand during transcription.


What would be the strand of complementary DNA produce by the strand of DNA tcg aag?

Purine- Adenine, guanine,pyrimidine- thymine, cytosineAdenine pairs with thymineGuanine pairs with cytosineTherefore the complementary strand to TCG AAG is AGC TTC=========================================================A always pairs with T, and C always pairs with G so the complementary strand is as follows:TCG AAG (Original)AGC TTC (Complementary)GCA TAT


What is the complementary strand of DNA AATAGTACGCGAGTCGTGATGAAATTCT?

The complementary strand of DNA for the sequence AATAGTACGCGAGTCGTGATGAAATTCT is TTATCATGCGCTCAGCACTACTTAAAGA. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base in the original strand is matched with its complementary base in the new strand.


What DNA strand attaches to atcgtta?

The complementary DNA strand that attaches to ATCGTTA is TAGCAAT. This is determined by the base pairing rules in DNA where adenine pairs with thymine and cytosine pairs with guanine.


What strand mrna would be produced from the strand of DNA gca tta?

UGA CUG


How many nitrogen base pairs are present in one strand of human DNA?

There are about 3 billion nitrogen base pairs present in one strand of human DNA.