When mRNA leaves the nucleus, it binds to ribosomes in the cytoplasm. This binding facilitates the process of translation, where the ribosome reads the mRNA sequence and synthesizes a corresponding protein by linking together the appropriate amino acids. Additionally, mRNA may associate with various translation factors and tRNA molecules to aid in protein synthesis.
The step of translation in which an mRNA, a small ribosomal subunit, and the initiator tRNA are aligned together is called initiation. This process occurs with the formation of the initiation complex, where the mRNA binds to the small ribosomal subunit and the initiator tRNA carrying methionine binds to the start codon on the mRNA.
The mRNA sequence produced from the DNA sequence "ATTCGACCTACG" would be "UAAGCUGGAUGC." This is achieved through the process of transcription, where RNA polymerase reads the DNA template and synthesizes a complementary mRNA strand.
mRNA becomes associated with ribosomes in the cytoplasm. Ribosomes are the cellular structures where mRNA is used as a template for protein synthesis. This association allows for translation, the process of converting the mRNA sequence into a protein.
mRNA is synthesized in the nucleus of eukaryotic cells during the process of transcription. In prokaryotic cells, which lack a nucleus, mRNA is synthesized in the cytoplasm. The enzyme RNA polymerase binds to DNA and produces the mRNA strand by assembling ribonucleotides complementary to the DNA template.
When pairing DNA to DNA - A binds to T and C binds to G. However, in RNA, the T is replaced with U. Therefore when DNA pairs with mRNA - A binds to U, C binds to G and T binds to A.
After transcription, the pre-mRNA undergoes splicing to remove introns and join exons to form mature mRNA. The mature mRNA then leaves the nucleus and binds to a ribosome in the cytoplasm for translation. During translation, the ribosome reads the mRNA codons and synthesizes a protein by linking amino acids together in the correct sequence.
After mRNA leaves the nucleus, it travels to the cytoplasm.
GAAGGCCUAGCUCCUUUCCGGUCA G binds to C and A binds to U. Remember that in RNA, uracil replaces thymine.
If a DNA strand read CCTAGCT, its mRNA would read GGAUCGA.
mRNA is transported out of the nucleus through nuclear pores in a process called mRNA export. Once in the cytoplasm, the mRNA binds to ribosomes where protein synthesis occurs.
The step of translation in which an mRNA, a small ribosomal subunit, and the initiator tRNA are aligned together is called initiation. This process occurs with the formation of the initiation complex, where the mRNA binds to the small ribosomal subunit and the initiator tRNA carrying methionine binds to the start codon on the mRNA.
Answer ?
The small ribosomal subunit binds to the mRNA The tRNA bearing methionine binds to the start codon , The large ribosomal subunit binds to the small one. The start codon signals the start of translation
A tRNA binds to an mRNA molecule at the ribosome during the process of protein synthesis.
During the process of protein synthesis, ribosomes bind to the mRNA to read and translate the genetic code into a protein.
The mRNA sequence produced from the DNA sequence "ATTCGACCTACG" would be "UAAGCUGGAUGC." This is achieved through the process of transcription, where RNA polymerase reads the DNA template and synthesizes a complementary mRNA strand.
mRNA becomes associated with ribosomes in the cytoplasm. Ribosomes are the cellular structures where mRNA is used as a template for protein synthesis. This association allows for translation, the process of converting the mRNA sequence into a protein.