answersLogoWhite

0

GAAGGCCUAGCUCCUUUCCGGUCA

G binds to C and A binds to U. Remember that in RNA, uracil replaces thymine.

User Avatar

Wiki User

15y ago

What else can I help you with?

Related Questions

Difference between sense and anti sense strands of DNA?

The sense strand of DNA is the strand that has the same sequence as the mRNA that is transcribed from DNA. The antisense strand is the complementary strand of the sense strand, which is used as a template for mRNA synthesis. The mRNA is transcribed from the antisense strand and contains the same sequence as the sense strand.


How is dna made into mRNA?

DNA is not made into mRNA, it is transcribed by mRNA. The DNA molecule is split into two strands by the enzyme helicase. One strand is the sense strand and the other is the anti-sense strand. Then mRNA nucleotides pair with their complimentary DNA bases on the antisense strand. The enzyme RNA polymerase causes the mRNA nucleotides to bond with one another, forming a strand of mRNA.


How many strand of mRNA are transcribed from the two unzipped strands of DNA?

One mRNA strand is made.


What strand is the messenger rna complementary to?

mRNA is complementary to the template strand of DNA during transcription. The template strand serves as a template for mRNA synthesis, directing the formation of a complementary mRNA transcript.


Name of the DNA strand which is copied to make mRNA?

The DNA strand that is copied to make mRNA is the template strand of the gene. This strand serves as a template for the RNA polymerase enzyme to synthesize a complementary mRNA strand during the process of transcription.


Which strand of dan molecule a or b was used to produce the messenger rna?

In the process of transcription, the template strand of DNA (often referred to as the antisense or non-coding strand) is used to produce messenger RNA (mRNA). This strand serves as the guide for RNA polymerase to synthesize the mRNA complementary to it. The other strand, known as the coding or sense strand, has a sequence that matches the mRNA (with uracil replacing thymine). Therefore, if strand A is the template, then mRNA is produced based on strand A.


Which strand of DNA transcribes into mRNA?

The strand running in the 3'-5' end will be the one that RNA copies, as this is the direction of transcription


The strand of DNA that is not transcribed is called the strand.?

The strand of DNA that is not transcribed is called the coding strand. This strand serves as the template for mRNA synthesis during transcription. The opposite strand, which is transcribed into mRNA, is known as the template strand.


What is the relationship between the template strand and the mRNA transcribed from it?

The template strand is used as a guide to create mRNA during transcription. The mRNA is complementary to the template strand and carries the genetic information from the DNA to the ribosome for protein synthesis.


What is formed when reverse transcriptase is used on of strand of mrna?

A strand of DNA


What is formed when reverse transcriptase is used on strand of mrna?

A strand of DNA


A DNA strand with the base sequence tgacgca codes for a strand of mrna the mrna will have what base sequence?

The mRNA sequence generated from the DNA strand tgacgca would be acugcgu. This is because mRNA is complementary to the DNA template strand, so DNA base T pairs with mRNA base A, DNA base G pairs with mRNA base C, DNA base A pairs with mRNA base U, and DNA base C pairs with mRNA base G.