0
What else can I help you with?
How is genetic code used to make proteins?
There are twenty amino acids in proteins, three bases in a codon and three bases in an anti-codon newly known as an anti-sense codon. If the codons make up mRNA , then the anti-sense codons are found in the transfer RNAs. A triplet codon corresponds to an amino acid. Adenine pairs with Uracil, and Guanine Pairs with Cytosine. Let's say we had a mRNA strand like: AUACGUACGUACGUCACGUGAUGCUACACCUGACAUCCGAUCAUGAGUCGAUCAUGAUGA (oops, there's no more) The first codon is AUA. The anti-codon UAU, would attach to it. AUA corresponds to the amino acid Tyrosine. Then the next anti-codon GCA would attach to the second codon CGU. Arginine corresponds to the codon CGU. Tyrosine would join together with Arginine. The bond of the Tyrosine and its tRNA breaks. This is all done by a ribosome. The process continues until the chain is complete.
How does the cell know which proteins to make from the DNA code?
Firstly, DNA is transcripted to mRNA, which is then translated by ribosomes into your polypeptide. Each set of 3 bases on the mRNA (codon) codes for a particular amino acid. However, there can be up to four codons, coding for a single amino acid. ie GCU, GCC, GCA and GCG all code for Alanine. Therefore, if you know the amino acid sequence, you can work backwards to mRNA and then to DNA, but you wouldn't be very accurate as you'd need to guess the codons.
What is the anticodon for Auggcauacaaguucgacggagcaaauuuugguacuuuguaa?
AUG also the start codon for protein synthesis. The amino acid will be Methionine, may want to double check spelling of that
What is the amino acid for GCG?
Serine (Ser) amino acid. --> This is response to the above answer. The question is for the anticodon, but the genetic code table is for CODONS. As you know codons and anticodons bind antiparallel to each other. So, the codon for anticodon AGU = ACU. The first base of the anticodon base paris to the 3rd base of the codon (i.e., wobble base). Therefore with this information the anticodon AGU codes for Threonine. I have a graduate degree in Molecular biology.
How many codons are needed to specify three amino acids 6 or 9?
The answer is nine because one codon has 3 letters.Improved AnswerThe above answer is completely incorrect. The question is how many codons are necessary to specify three amino acids, not bases (letters). As my original answer (which was removed by the previouis contributor) pointed out, each amino acid requires one codon to specify it, so the basic answer is, three codons are necessary to specify any three amino acids. However, if the questioner had in mind how many codons are necessary to specify a polypeptide consisting of three amino acids, the answer is five, because, in addition to the three codons necessary for the amino acids, a start codon of AUG (on the mRNA transcript), and one stop codon (UAG, UGA,or UAA on the mRNA transcipt) are also needed. So, in this sense, five codons are needed to specify a polypeptide of 3 amino acids.Improved Answer: The answer is 9. ^ fail XD
What are AGG and GCA and GUU examples of?
AGG, GCA, and GUU are examples of codons in the genetic code. Codons are groups of three nucleotides that specify a particular amino acid during protein synthesis. Each codon corresponds to a specific amino acid, allowing the cell to translate the genetic information stored in DNA into proteins.
What is the amino acid sequence when given mRNA?
To determine the amino acid sequence from mRNA, you would first transcribe the mRNA into a complementary DNA sequence, then translate the DNA sequence into amino acids using the genetic code. Each set of three nucleotides (codon) in the mRNA corresponds to a specific amino acid in the protein.
Four examples of codons and state the instructions they encode?
AUG - codes for the start of translation and the amino acid methionine. UAA - codes for a stop signal to terminate translation. GCA - codes for the amino acid alanine. CAG - codes for the amino acid glutamine.
How is genetic code used to make proteins?
There are twenty amino acids in proteins, three bases in a codon and three bases in an anti-codon newly known as an anti-sense codon. If the codons make up mRNA , then the anti-sense codons are found in the transfer RNAs. A triplet codon corresponds to an amino acid. Adenine pairs with Uracil, and Guanine Pairs with Cytosine. Let's say we had a mRNA strand like: AUACGUACGUACGUCACGUGAUGCUACACCUGACAUCCGAUCAUGAGUCGAUCAUGAUGA (oops, there's no more) The first codon is AUA. The anti-codon UAU, would attach to it. AUA corresponds to the amino acid Tyrosine. Then the next anti-codon GCA would attach to the second codon CGU. Arginine corresponds to the codon CGU. Tyrosine would join together with Arginine. The bond of the Tyrosine and its tRNA breaks. This is all done by a ribosome. The process continues until the chain is complete.
How does the cell know which proteins to make from the DNA code?
Firstly, DNA is transcripted to mRNA, which is then translated by ribosomes into your polypeptide. Each set of 3 bases on the mRNA (codon) codes for a particular amino acid. However, there can be up to four codons, coding for a single amino acid. ie GCU, GCC, GCA and GCG all code for Alanine. Therefore, if you know the amino acid sequence, you can work backwards to mRNA and then to DNA, but you wouldn't be very accurate as you'd need to guess the codons.
What is the anticodon for Auggcauacaaguucgacggagcaaauuuugguacuuuguaa?
AUG also the start codon for protein synthesis. The amino acid will be Methionine, may want to double check spelling of that
A part of an mRNA has the sequence CCG. which change to this sequence would indicate a missense mutation?
CGG GAA
What is the amino acid for GCG?
Serine (Ser) amino acid. --> This is response to the above answer. The question is for the anticodon, but the genetic code table is for CODONS. As you know codons and anticodons bind antiparallel to each other. So, the codon for anticodon AGU = ACU. The first base of the anticodon base paris to the 3rd base of the codon (i.e., wobble base). Therefore with this information the anticodon AGU codes for Threonine. I have a graduate degree in Molecular biology.
How many codons are needed to specify three amino acids 6 or 9?
The answer is nine because one codon has 3 letters.Improved AnswerThe above answer is completely incorrect. The question is how many codons are necessary to specify three amino acids, not bases (letters). As my original answer (which was removed by the previouis contributor) pointed out, each amino acid requires one codon to specify it, so the basic answer is, three codons are necessary to specify any three amino acids. However, if the questioner had in mind how many codons are necessary to specify a polypeptide consisting of three amino acids, the answer is five, because, in addition to the three codons necessary for the amino acids, a start codon of AUG (on the mRNA transcript), and one stop codon (UAG, UGA,or UAA on the mRNA transcipt) are also needed. So, in this sense, five codons are needed to specify a polypeptide of 3 amino acids.Improved Answer: The answer is 9. ^ fail XD
What does the g and a represent in the DNA sequence GAA ttc gca?
In the DNA sequence GAA ttc gca, "G" represents guanine, "A" represents adenine. These are the nucleotide bases that make up the DNA sequence.
What part of a strand of DNA tells the cell what protein to make?
DNA tells a cell how to make proteins through the genetic code. Both DNA and proteins are long molecules made from strings of shorter building blocks. While DNA is made of nucleotides, proteins are made of amino acids, a group of 20 different chemicals with names like alanine, arginine, and serine. The genetic code enables a cell to translate the nucleotide language of DNA into the amino acid language of proteins. In the genetic code, each group of three nucleotides-known as a "triplet" or "codon"-stands for a specific amino acid. For example, GCA stands for alanine, AGA stands for arginine, and AGC stands for serine. There are 64 possible codons, but only 20 amino acids, so more than one codon may code for a single amino acid. For example, GCA, GCC, and GCG all mean alanine. For the most part, the genetic code is the same across every form of life, from bacteria to sea stars to German shepherds to humans. A few species might translate a codon or two differently-GCA means alanine for most species, but could mean valine in a few organisms. But everyone uses three-letter codons and most of the same codon-amino acid relationships.
Which export is gca EXPORT?
export obligation to export to GCA countries
