G stands for Guanine, which always pairs with Cytosine. A stands for Adenine, which always pairs with Thymine.
Nitrogen bases.
tttactgttgatggtagaactcgttgttct
If the tRNA has the sequence UUA, then the mRNA it reads from will have the sequence complementary to UUA, which is AAU. RNA uses the nucleic acid uracil instead of the DNA counterpart, thymine.
CGG GAA
5`... ccagattg ... 3` 3`... ggtctaac ... 5`Remember always A complementarly binds with t with a double bond (hydrogens bonds)(a=t) in the same way g with c by means of 3hydrogen bonds between them.....
The sequence TGA-GCC-ATG-A is changed in 2 places to become TGA-GCA-CAT-GA.When one base is changed, it is called a point mutation.In this case, a GCC in the DNA has been changed to a GCA. This would mean the mRNA codon (coded for by this DNA) would change from CGG to CGU.Both of these codons code for the same amino acid - Arginine. Therefore this type of point mutation is known as a silent mutation.The extra C that appears would be called an addition mutation, which is a type of frameshift mutation.
tttactgttgatggtagaactcgttgttct
complimentary For example, if the DNA codon is GCA, the complimentary mRNA codon will be CGU, according to the base pairing rule.
give the complementary DNA sequence of 5' atg ctt gca cca gtg tga aaa agg gcg?
Gca-tat gca ta The answer is AGC CT cat gt
If the tRNA has the sequence UUA, then the mRNA it reads from will have the sequence complementary to UUA, which is AAU. RNA uses the nucleic acid uracil instead of the DNA counterpart, thymine.
5`... ccagattg ... 3` 3`... ggtctaac ... 5`Remember always A complementarly binds with t with a double bond (hydrogens bonds)(a=t) in the same way g with c by means of 3hydrogen bonds between them.....
CGG GAA
The sequence TGA-GCC-ATG-A is changed in 2 places to become TGA-GCA-CAT-GA.When one base is changed, it is called a point mutation.In this case, a GCC in the DNA has been changed to a GCA. This would mean the mRNA codon (coded for by this DNA) would change from CGG to CGU.Both of these codons code for the same amino acid - Arginine. Therefore this type of point mutation is known as a silent mutation.The extra C that appears would be called an addition mutation, which is a type of frameshift mutation.
TAC AAA TTT GCA ACC ACT (DNA) AUG UUU AAA CGU UGG UGA (mRNA)
The sequence TGA-GCC-ATG-A is changed in 2 places to become TGA-GCA-CAT-GA.When one base is changed, it is called a point mutation.In this case, a GCC in the DNA has been changed to a GCA. This would mean the mRNA codon (coded for by this DNA) would change from CGG to CGU.Both of these codons code for the same amino acid - Arginine. Therefore this type of point mutation is known as a silent mutation.The extra C that appears would be called an addition mutation, which is a type of frameshift mutation.
Aca tag gct aat gct aat cgt gca cga tct gaa cgatgt atc cga tta cga tta gca cgt gct aga ctt gct
Ttg ga