answersLogoWhite

0


Best Answer

G stands for Guanine, which always pairs with Cytosine. A stands for Adenine, which always pairs with Thymine.

User Avatar

Wiki User

14y ago
This answer is:
User Avatar
More answers
User Avatar

Wiki User

10y ago

Nitrogen bases.

This answer is:
User Avatar

Add your answer:

Earn +20 pts
Q: What does the g and a represent in the DNA sequence GAA ttc gca?
Write your answer...
Submit
Still have questions?
magnify glass
imp
Continue Learning about Biology
Related questions

Consider a strand of DNA with this sequence AAA tga caa cta cca tct tga gca aca aga what is the corresponding sequence of the other side of the DNA helix how would you get the answer?

tttactgttgatggtagaactcgttgttct


The base sequence of RNA is what to the DNA from which it is transcribed?

complimentary For example, if the DNA codon is GCA, the complimentary mRNA codon will be CGU, according to the base pairing rule.


What is the complementary strand to AGTCACGGTATCTA?

give the complementary DNA sequence of 5' atg ctt gca cca gtg tga aaa agg gcg?


What complementary strands of DNA would be produced from the strand of DNA?

Gca-tat gca ta The answer is AGC CT cat gt


What order of bases on mRNA will match a sequence on tRNA of UUA?

If the tRNA has the sequence UUA, then the mRNA it reads from will have the sequence complementary to UUA, which is AAU. RNA uses the nucleic acid uracil instead of the DNA counterpart, thymine.


Along one strand of a DNA double helix is the nucleotide sequence ggcataggt what is the sequence for the mRNA strand?

5`... ccagattg ... 3` 3`... ggtctaac ... 5`Remember always A complementarly binds with t with a double bond (hydrogens bonds)(a=t) in the same way g with c by means of 3hydrogen bonds between them.....


A part of an mRNA has the sequence CCG. which change to this sequence would indicate a missense mutation?

CGG GAA


What kind of mutation is this ugu-ccg-GAA-cga to ugc-cgg-GAA-cga?

The sequence TGA-GCC-ATG-A is changed in 2 places to become TGA-GCA-CAT-GA.When one base is changed, it is called a point mutation.In this case, a GCC in the DNA has been changed to a GCA. This would mean the mRNA codon (coded for by this DNA) would change from CGG to CGU.Both of these codons code for the same amino acid - Arginine. Therefore this type of point mutation is known as a silent mutation.The extra C that appears would be called an addition mutation, which is a type of frameshift mutation.


What is the sequence of bases of the mrna for tacaaatttgcaaccact?

TAC AAA TTT GCA ACC ACT (DNA) AUG UUU AAA CGU UGG UGA (mRNA)


If the dNA sequence Tgagccatga is change to tgagcacatga what kind of mutation has occurred?

The sequence TGA-GCC-ATG-A is changed in 2 places to become TGA-GCA-CAT-GA.When one base is changed, it is called a point mutation.In this case, a GCC in the DNA has been changed to a GCA. This would mean the mRNA codon (coded for by this DNA) would change from CGG to CGU.Both of these codons code for the same amino acid - Arginine. Therefore this type of point mutation is known as a silent mutation.The extra C that appears would be called an addition mutation, which is a type of frameshift mutation.


What are the steps involved in transcription and translation of a gene?

Aca tag gct aat gct aat cgt gca cga tct gaa cgatgt atc cga tta cga tta gca cgt gct aga ctt gct


What strand of DNA would be produced from from the template strand of DNA shown below?

Ttg ga