0
What else can I help you with?
Does BSNL provide CUG scheme?
yes, BSNL provides CUG scheme. The conditions varies depending on the number of members in the group. BSNL also provides VPN schemes
How do you write a CUG SIM Request letter to Mobile company?
[object Object]
What is the name of small lion?
A young lion is called a cub.
What strand mrna would be produced from the strand of DNA gca tta?
UGA CUG
How do you translate this to to messenger RNA from DNA ccg atc gac cga?
To transcribe DNA to messenger RNA, you need to replace each DNA base with its RNA complement: G in DNA is transcribed to C in mRNA, C to G, A to U (uracil), and T to A. Therefore, the DNA sequence ccg atc gac cga would be transcribed to GGC UAG CUG GCU in mRNA.
What are the codons and anticodons for the sequence auguucguuaacgaccaaauuuaa?
It would be UAC. RNA does not use thymine. It replaces it with Uracil. So instead of TAC it will be UAC.
What strand of mrna would be produced from the strand of DNA shown below gct aag?
GCT AAG would produce the strand of mRNA of "CGA UUC" CGU AAU UGA CUG
What are the different codons for leucine and proline?
LeucineCUUCUCCUACUGUUAUUGProlineCCUCCCCCACCG
How many mRNA sequences can code for the simple tripeptide sequence leu-met-tyr?
12: UUA-AUG-UAU UUA-AUG-UAC UUG-AUG-UAU UUG-AUG-UAC CUU-AUG-UAU CUU-AUG-UAC CUC-AUG-UAU CUC-AUG-UAC CUA-AUG-UAU CUA-AUG-UAC CUG-AUG-UAU CUG-AUG-UAC
What codes for three amino acids?
It is the DNA bases which can trascribe to RNA and then to proteins(polymer of aminoacids)
A gene has the base sequence that starts with TCG GAC CAT CGAg b) What would be the mRNA base sequence formed from this DNA?
The mRNA sequence transcribed from the given DNA sequence is AGC CUG GUA GCU. The DNA base T pairs with A in mRNA, C pairs with G, G pairs with C, and A pairs with U.
What is a peekage and a fuzz?
"Peekage" is not a commonly used term, so it is unclear what it refers to. "Fuzz" typically refers to a type of distortion effect in electric guitar pedals or amplifiers that adds a fuzzy or buzzy tone to the sound. It is popular in genres like rock and blues.
