answersLogoWhite

0

In Super Mario Sunshine, a CUG (Coconut Under Glass) can be found in the level Pianta Village. To obtain it, you need to break open the glass case that contains the CUG by using Yoshi. First, you must find a coconut and bring it to Yoshi, then use Yoshi's juice to melt the glass covering the CUG. Once the glass is gone, you can collect the CUG.

User Avatar

AnswerBot

2mo ago

What else can I help you with?

Related Questions

How do you write a CUG SIM Request letter to Mobile company?

[object Object]


What does cug code for?

CUG codes for the amino acid leucine in the genetic code. It is one of the codons that specify this particular amino acid during protein synthesis. Additionally, CUG can also serve as a start codon in some organisms, initiating the translation process.


Does BSNL provide CUG scheme?

yes, BSNL provides CUG scheme. The conditions varies depending on the number of members in the group. BSNL also provides VPN schemes


What is the name of small lion?

A young lion is called a cub.


What is meaning of CUG under bsnl scheme?

CUG stands for "Closed User Group" under BSNL (Bharat Sanchar Nigam Limited) schemes. It refers to a service plan that allows a group of users, such as employees of a company or members of an organization, to communicate with each other at reduced rates or for free. CUG plans typically enable seamless connectivity among group members while limiting communication to those within the specified group. This is beneficial for businesses seeking cost-effective communication solutions.


What strand mrna would be produced from the strand of DNA gca tta?

UGA CUG


How do you translate this to to messenger RNA from DNA ccg atc gac cga?

To transcribe DNA to messenger RNA, you need to replace each DNA base with its RNA complement: G in DNA is transcribed to C in mRNA, C to G, A to U (uracil), and T to A. Therefore, the DNA sequence ccg atc gac cga would be transcribed to GGC UAG CUG GCU in mRNA.


What are the codons and anticodons for the sequence auguucguuaacgaccaaauuuaa?

It would be UAC. RNA does not use thymine. It replaces it with Uracil. So instead of TAC it will be UAC.


What is a CUG?

A CUG, or "common user group," refers to a collection of individuals or entities that share access to certain resources or services within a system, typically for collaboration or shared interests. In the context of computer networks or information technology, it often denotes a group of users granted similar permissions to access particular data or applications. CUGs are commonly utilized in organizational settings to streamline communication and resource sharing among members with similar roles or responsibilities.


What strand of mrna would be produced from the strand of DNA shown below gct aag?

GCT AAG would produce the strand of mRNA of "CGA UUC" CGU AAU UGA CUG


What are the different codons for leucine and proline?

LeucineCUUCUCCUACUGUUAUUGProlineCCUCCCCCACCG


How many mRNA sequences can code for the simple tripeptide sequence leu-met-tyr?

12: UUA-AUG-UAU UUA-AUG-UAC UUG-AUG-UAU UUG-AUG-UAC CUU-AUG-UAU CUU-AUG-UAC CUC-AUG-UAU CUC-AUG-UAC CUA-AUG-UAU CUA-AUG-UAC CUG-AUG-UAU CUG-AUG-UAC