0
What else can I help you with?
How many different condons are for leucine?
Leucine is encoded by six different codons in the genetic code: UUA, UUG, CUU, CUC, CUA, and CUG. These codons correspond to the amino acid leucine during protein synthesis. The redundancy in codons for leucine is an example of the genetic code's degeneracy, where multiple codons can specify the same amino acid.
There can be more than one for the same amino acid?
Yes, multiple codons can code for the same amino acid in the genetic code. This redundancy in the genetic code is known as degeneracy. For example, the amino acid leucine is specified by six different codons: UUA, UUG, CUU, CUC, CUA, and CUG.
Is there only one mRNA code for each amino acid?
No, there is not just one mRNA code for each amino acid. In the genetic code, multiple codons (three-nucleotide sequences) can specify the same amino acid, a phenomenon known as redundancy or degeneracy of the genetic code. For example, the amino acid leucine is encoded by six different codons (UUA, UUG, CUU, CUC, CUA, CUG). This redundancy helps mitigate the effects of mutations in the DNA sequence.
How do you translate this to to messenger RNA from DNA ccg atc gac cga?
To transcribe DNA to messenger RNA, you need to replace each DNA base with its RNA complement: G in DNA is transcribed to C in mRNA, C to G, A to U (uracil), and T to A. Therefore, the DNA sequence ccg atc gac cga would be transcribed to GGC UAG CUG GCU in mRNA.
What is a CUG?
A CUG, or "common user group," refers to a collection of individuals or entities that share access to certain resources or services within a system, typically for collaboration or shared interests. In the context of computer networks or information technology, it often denotes a group of users granted similar permissions to access particular data or applications. CUGs are commonly utilized in organizational settings to streamline communication and resource sharing among members with similar roles or responsibilities.
How do you find a cug in super Mario sunshine?
In Super Mario Sunshine, a CUG (Coconut Under Glass) can be found in the level Pianta Village. To obtain it, you need to break open the glass case that contains the CUG by using Yoshi. First, you must find a coconut and bring it to Yoshi, then use Yoshi's juice to melt the glass covering the CUG. Once the glass is gone, you can collect the CUG.
How do you write a CUG SIM Request letter to Mobile company?
[object Object]
Does BSNL provide CUG scheme?
yes, BSNL provides CUG scheme. The conditions varies depending on the number of members in the group. BSNL also provides VPN schemes
What is the name of small lion?
A young lion is called a cub.
How many mRNA sequences can code for the simple tripeptide sequence leu-met-tyr?
12: UUA-AUG-UAU UUA-AUG-UAC UUG-AUG-UAU UUG-AUG-UAC CUU-AUG-UAU CUU-AUG-UAC CUC-AUG-UAU CUC-AUG-UAC CUA-AUG-UAU CUA-AUG-UAC CUG-AUG-UAU CUG-AUG-UAC
How many different condons are for leucine?
Leucine is encoded by six different codons in the genetic code: UUA, UUG, CUU, CUC, CUA, and CUG. These codons correspond to the amino acid leucine during protein synthesis. The redundancy in codons for leucine is an example of the genetic code's degeneracy, where multiple codons can specify the same amino acid.
What is meaning of CUG under bsnl scheme?
CUG stands for "Closed User Group" under BSNL (Bharat Sanchar Nigam Limited) schemes. It refers to a service plan that allows a group of users, such as employees of a company or members of an organization, to communicate with each other at reduced rates or for free. CUG plans typically enable seamless connectivity among group members while limiting communication to those within the specified group. This is beneficial for businesses seeking cost-effective communication solutions.
There can be more than one for the same amino acid?
Yes, multiple codons can code for the same amino acid in the genetic code. This redundancy in the genetic code is known as degeneracy. For example, the amino acid leucine is specified by six different codons: UUA, UUG, CUU, CUC, CUA, and CUG.
Is there only one mRNA code for each amino acid?
No, there is not just one mRNA code for each amino acid. In the genetic code, multiple codons (three-nucleotide sequences) can specify the same amino acid, a phenomenon known as redundancy or degeneracy of the genetic code. For example, the amino acid leucine is encoded by six different codons (UUA, UUG, CUU, CUC, CUA, CUG). This redundancy helps mitigate the effects of mutations in the DNA sequence.
What strand mrna would be produced from the strand of DNA gca tta?
UGA CUG
How do you translate this to to messenger RNA from DNA ccg atc gac cga?
To transcribe DNA to messenger RNA, you need to replace each DNA base with its RNA complement: G in DNA is transcribed to C in mRNA, C to G, A to U (uracil), and T to A. Therefore, the DNA sequence ccg atc gac cga would be transcribed to GGC UAG CUG GCU in mRNA.
What are the codons and anticodons for the sequence auguucguuaacgaccaaauuuaa?
It would be UAC. RNA does not use thymine. It replaces it with Uracil. So instead of TAC it will be UAC.
